ID: 1097378400

View in Genome Browser
Species Human (GRCh38)
Location 12:58865249-58865271
Sequence GAGCCAGCTGTGTATTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097378400_1097378403 19 Left 1097378400 12:58865249-58865271 CCTAAGGAATACACAGCTGGCTC No data
Right 1097378403 12:58865291-58865313 ACTACATGGGTCCATTTATATGG No data
1097378400_1097378401 5 Left 1097378400 12:58865249-58865271 CCTAAGGAATACACAGCTGGCTC No data
Right 1097378401 12:58865277-58865299 CAGTCTGAATTTGAACTACATGG No data
1097378400_1097378402 6 Left 1097378400 12:58865249-58865271 CCTAAGGAATACACAGCTGGCTC No data
Right 1097378402 12:58865278-58865300 AGTCTGAATTTGAACTACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097378400 Original CRISPR GAGCCAGCTGTGTATTCCTT AGG (reversed) Intergenic
No off target data available for this crispr