ID: 1097378401

View in Genome Browser
Species Human (GRCh38)
Location 12:58865277-58865299
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097378400_1097378401 5 Left 1097378400 12:58865249-58865271 CCTAAGGAATACACAGCTGGCTC No data
Right 1097378401 12:58865277-58865299 CAGTCTGAATTTGAACTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097378401 Original CRISPR CAGTCTGAATTTGAACTACA TGG Intergenic
No off target data available for this crispr