ID: 1097379949

View in Genome Browser
Species Human (GRCh38)
Location 12:58882799-58882821
Sequence CATTATTTGGATAAATGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097379943_1097379949 27 Left 1097379943 12:58882749-58882771 CCTCAGCAGAAATAAAAGCTTTA 0: 1
1: 0
2: 7
3: 34
4: 381
Right 1097379949 12:58882799-58882821 CATTATTTGGATAAATGGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097379949 Original CRISPR CATTATTTGGATAAATGGGA GGG Intronic
902240818 1:15088225-15088247 CTTTATTTAGAAAAATAGGAGGG + Intronic
910683765 1:89894613-89894635 CATTATTTGGCTAAAGTGAATGG + Intronic
911795636 1:102072219-102072241 CTTTATTAGTTTAAATGGGAAGG + Intergenic
912469261 1:109895424-109895446 TATTTTTTGGATAGATGGAAGGG + Intergenic
912580161 1:110713783-110713805 CATTGTTCTGAGAAATGGGATGG - Intergenic
916434242 1:164761810-164761832 CTTTATTTGGATCAGTGTGAGGG + Intronic
917500332 1:175579569-175579591 AGTCATTTGGATGAATGGGATGG + Intronic
919138996 1:193546419-193546441 CATTTTTGGGGTAAAGGGGAAGG + Intergenic
920127063 1:203701751-203701773 CATTGCTTGGAAAAATGGGGTGG - Intronic
923046088 1:230356730-230356752 GATTATGTGGATTAATGGAATGG + Intronic
924919104 1:248607480-248607502 CATAATTTGCATAAATTGAACGG - Intergenic
1064252335 10:13716378-13716400 CATTGTTTGGGTATTTGGGAGGG - Intronic
1064298428 10:14099996-14100018 CAGTGTTTGTATAAATGGCAGGG - Intronic
1064596641 10:16952312-16952334 GATTGTTTGGATAATTGGCAGGG + Exonic
1067377108 10:45737657-45737679 CATTATTAGGTTAAATGAAAAGG + Intronic
1067884814 10:50078351-50078373 CATTATTAGGTTAAATGAAAAGG + Intronic
1068628019 10:59270395-59270417 CATTATTTGCATAAGTCAGAGGG + Intronic
1069645153 10:69991446-69991468 CTATATTTGGAAAAATGGGGAGG + Intergenic
1070183502 10:74037505-74037527 CAATCTTTGAATAAATGGGCAGG + Intronic
1070190854 10:74110796-74110818 CATTCTTTGTATAAATGGTTTGG + Intronic
1071118227 10:82248578-82248600 TATTTTTTGGATGAATGGGAGGG + Intronic
1071663731 10:87532117-87532139 CATTATTTGGACAATTGCCAAGG - Intronic
1073484815 10:103809990-103810012 CACTATTTATTTAAATGGGAGGG + Intronic
1075503752 10:123002974-123002996 GATTATTTGGAAAAAATGGATGG + Intronic
1076012141 10:126997824-126997846 CATTATTTTGATTTATTGGATGG + Intronic
1077741578 11:4851498-4851520 CAATATATGGGTAAATGTGAAGG + Intronic
1077817373 11:5698712-5698734 CATTAAGTGTATGAATGGGAAGG + Intronic
1078483210 11:11698148-11698170 CAGTATTTGGATTAGTGGGTTGG - Intergenic
1078619131 11:12891777-12891799 CACTATCTGGGAAAATGGGAAGG + Intronic
1079252915 11:18800564-18800586 CTTTATTTGTATAAATGTAAGGG - Intergenic
1079391862 11:20028814-20028836 CTTTCTTTGGATAAATAGCATGG + Intronic
1081235499 11:40642954-40642976 CTTTAATGGGATAAATAGGAAGG - Intronic
1081345963 11:41986501-41986523 CATTTGTTGAATAAATGGCAGGG - Intergenic
1084324707 11:68393313-68393335 AATTATTTGGATATATGTGTAGG + Intronic
1088330689 11:108647908-108647930 CACTATCTGGATTAAGGGGAGGG - Intergenic
1088461439 11:110087565-110087587 CATTGTTTGGTGAAAAGGGAAGG - Intergenic
1088774557 11:113069777-113069799 CATTATTTTGGTAGACGGGAGGG + Intronic
1089020621 11:115210486-115210508 AATTATTTGGAGACAAGGGAGGG + Intronic
1090199104 11:124841506-124841528 CATTATTTTGATAAATAATAAGG - Intergenic
1090429795 11:126636143-126636165 CTTCATTTGTAAAAATGGGAAGG + Intronic
1091807978 12:3369605-3369627 CCTTATTTGGAAAAATAGGAGGG + Intergenic
1092550019 12:9487882-9487904 CAATATCTGGAAAAATTGGAAGG - Intergenic
1095881087 12:47137236-47137258 CATTAATTGTTTAAATGTGAAGG - Intronic
1097379949 12:58882799-58882821 CATTATTTGGATAAATGGGAGGG + Intronic
1098929530 12:76395035-76395057 CATTAGTTGTATCCATGGGATGG - Intronic
1099689857 12:85938588-85938610 AATTATTTGGCTGAATGGGCAGG + Intergenic
1100866653 12:98864883-98864905 CATAAATGGGATAAATGGCAGGG - Intronic
1101022779 12:100570843-100570865 CAAAATTTGGCTAAATGGGGTGG + Intergenic
1102715284 12:114965740-114965762 GGTTATTTGTATAAGTGGGATGG + Intergenic
1102785823 12:115603929-115603951 CATTATTGGATTAAATGAGATGG + Intergenic
1103887272 12:124212085-124212107 CATTATATGGAAATATGGAAAGG - Intronic
1103945121 12:124521659-124521681 CATTTTTTGGATAGAAGGGGTGG + Intronic
1106856992 13:33864331-33864353 CATTCTTTGGCTAAATGATATGG - Intronic
1107280650 13:38730015-38730037 AATTATTTGGATAATTGTGTAGG + Intronic
1107883952 13:44858469-44858491 CTTAATTAGGATAAATGGCAAGG - Intergenic
1108385102 13:49892523-49892545 CCTTCTTTGGATAAAATGGATGG + Intergenic
1108590519 13:51908673-51908695 CCTTCTTTGGATAAAATGGATGG - Intergenic
1108591688 13:51918123-51918145 CATTATTTTGAGAACTGTGATGG - Intergenic
1108786141 13:53903467-53903489 CATTATTTTGAAAAATGGAAGGG + Intergenic
1108972521 13:56394820-56394842 CATTATCTGTAAAAATGGGTAGG - Intergenic
1110082011 13:71325690-71325712 TGTTATTTGAATAAATGGCACGG + Intergenic
1110414626 13:75238394-75238416 CCTTCTTTGGATAAAATGGATGG - Intergenic
1110415963 13:75253145-75253167 CATTATTAGAATATTTGGGATGG + Intergenic
1111682032 13:91455042-91455064 AATTAAATGGATAAAAGGGATGG - Intronic
1112342467 13:98564032-98564054 CATTATTAAAATAAATGGGGGGG + Intronic
1112636199 13:101220793-101220815 TATTATCTGTATAAATGGCAAGG - Intronic
1114785804 14:25597137-25597159 CATCATTTGGGTAAATGGAATGG - Intergenic
1114843181 14:26289973-26289995 CATTATATGGATAAAAAGTAAGG - Intergenic
1114979664 14:28147261-28147283 CATTATTAGAAAAGATGGGAAGG + Intergenic
1115468260 14:33739850-33739872 CACTGGATGGATAAATGGGAGGG - Intronic
1115805630 14:37048007-37048029 CATTCTTTGGATAGCTGTGATGG - Intronic
1116033722 14:39603427-39603449 GAGTATTTGTATAAATGGGTAGG - Intergenic
1116369939 14:44117596-44117618 AAGTATTTGGATAATGGGGATGG - Intergenic
1117180128 14:53182958-53182980 AATTATGTGGATAAAGGGGCAGG + Intergenic
1117732366 14:58736318-58736340 GATAATTTGGATGAATGGGAAGG - Intergenic
1119255506 14:73192569-73192591 CATTATTTAGAATAATGTGATGG - Intronic
1119439958 14:74621605-74621627 CATAAATTGAAGAAATGGGATGG - Intergenic
1119495451 14:75074504-75074526 TATTATTTGGAAATATGGAAAGG - Intronic
1121402353 14:93691021-93691043 CATCATTTGGATCATTGGGATGG - Intronic
1125397167 15:39261652-39261674 CAATAATTGGATATATGTGAAGG + Intergenic
1126377301 15:48009044-48009066 AATTATTTAGGTAAATGGGATGG - Intergenic
1127608999 15:60618815-60618837 CAAGATTTGGAGAAATGGCAAGG - Intronic
1129811175 15:78511404-78511426 TATGATTTGGATACATGGGCGGG - Intronic
1130068219 15:80623886-80623908 CATACTTTGGATGAATGGTATGG + Intergenic
1131744619 15:95433715-95433737 GATTATTGGGATAGATGAGATGG + Intergenic
1141356517 16:83351731-83351753 CATGAGCTGGATTAATGGGATGG + Intronic
1142064114 16:88050645-88050667 CATCATTTGGATAAGTGTGAGGG + Intronic
1146204782 17:30893881-30893903 CTTTAGTTGGACAAATGGAAAGG + Exonic
1148209584 17:45800156-45800178 CATGATTTGGAAAAAAGGAAAGG - Intronic
1148543665 17:48500578-48500600 AATTATTGAGATAAACGGGAGGG + Intergenic
1148931163 17:51128434-51128456 CATTTCTTGTATAATTGGGAGGG - Intergenic
1149277536 17:55060311-55060333 CAATCTTTGGAAAAATGGAAAGG - Intronic
1149382756 17:56110288-56110310 AATTAACTAGATAAATGGGACGG - Intergenic
1155081619 18:22415947-22415969 CCTTCTTTGGATAAAATGGATGG - Exonic
1155876787 18:31099811-31099833 GATTACTTGGGTATATGGGAAGG + Intronic
1156845362 18:41659465-41659487 AAATATTTGGGGAAATGGGAAGG + Intergenic
1158547714 18:58410216-58410238 CTAGATTTGGATATATGGGAAGG - Intergenic
1166488835 19:43239745-43239767 TCTTCTTTGGAGAAATGGGAGGG + Intronic
925285112 2:2710643-2710665 CCTTATGTGGGTAAATGGGTGGG - Intergenic
925852930 2:8100532-8100554 CATTATTTGAGTAAGTAGGAAGG - Intergenic
926485188 2:13445303-13445325 CATTAATTAGGTAAATGGGGAGG + Intergenic
926879760 2:17531521-17531543 CATTATATGGATCATTGGCAAGG + Intergenic
927018215 2:18990452-18990474 CATCATTTGAATGAATGCGAAGG - Intergenic
927545588 2:23949886-23949908 AATTATTTGTATAAATGTGTGGG + Intronic
929349407 2:40930435-40930457 AATTATTTTAATAAATGGTAGGG + Intergenic
930774168 2:55156533-55156555 CAGGATTTGCATAAATGGAAAGG - Intergenic
931130018 2:59325317-59325339 AAATATTTGGATAAATGAGCAGG + Intergenic
931163519 2:59719967-59719989 CTTTATTTGAATGAATGAGAGGG - Intergenic
933313491 2:80688960-80688982 CACTATTTTGCTAAATGGCAAGG - Intergenic
937416149 2:121716379-121716401 CTCTAATTGGATCAATGGGACGG + Intergenic
938983224 2:136546477-136546499 CATTTTTCAGTTAAATGGGAGGG - Intergenic
941615513 2:167714110-167714132 CCTTGTTTGGATAAAATGGATGG - Intergenic
941706151 2:168660281-168660303 CTTTATTTGGAGAGGTGGGAAGG - Intronic
941839895 2:170070224-170070246 TATTAATTGAATAAATGGGGGGG + Intronic
943709302 2:191072545-191072567 TATTATTTTTATAAATGGCAAGG + Intronic
944499324 2:200342072-200342094 CATGATTTAGAAAAAAGGGAGGG - Intronic
945549650 2:211204973-211204995 CATAATTAGGACCAATGGGAAGG - Intergenic
945563279 2:211364737-211364759 CATTATTTAGACCATTGGGAAGG + Intergenic
945637677 2:212376863-212376885 CATTCTTTGAACATATGGGAAGG - Intronic
948006968 2:234617566-234617588 CAGTTTTAGGATTAATGGGAAGG + Intergenic
1169742840 20:8914045-8914067 CTTTAAATGGATAAATGTGATGG - Intronic
1169904664 20:10590240-10590262 CATTAATTGTATAAATGTGTGGG - Intronic
1170231463 20:14051477-14051499 CATACTTTGGGTAAAAGGGAAGG - Intronic
1170315317 20:15034880-15034902 TGCTATTTGTATAAATGGGAGGG - Intronic
1172819141 20:37717078-37717100 GATGTTTTGGAAAAATGGGAAGG - Intronic
1174975750 20:55331842-55331864 CAGCATTTGGTTAAATGGAAAGG + Intergenic
1178886306 21:36487426-36487448 GATTATTTCAAGAAATGGGAGGG - Intronic
1178996004 21:37400417-37400439 AATTATTTGGAAAAGTAGGAAGG + Intronic
1180507555 22:16028959-16028981 AATTATTTTGAAAAATGGGAGGG + Intergenic
949278397 3:2316582-2316604 CACTGTTTGGATAAATGAAAGGG - Intronic
950175661 3:10872401-10872423 CATTACTTGGAAAATGGGGATGG - Intronic
950693454 3:14679316-14679338 TAGAAATTGGATAAATGGGAAGG + Intronic
952230283 3:31422516-31422538 CATTCATTGGACAGATGGGAAGG - Intergenic
952255082 3:31688048-31688070 CATTAATATCATAAATGGGAGGG + Intronic
956305265 3:67817081-67817103 AAGTATTTGGAGAAAAGGGAGGG + Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957429230 3:80080064-80080086 CATTATTTGGCTAAGTGATAGGG + Intergenic
958625533 3:96618164-96618186 CTTTATTTGGGTAAATGGTTTGG + Exonic
961394454 3:126577543-126577565 CATTGATTAGATAAAGGGGAAGG + Intronic
961615659 3:128177936-128177958 CATTCTTTATATAAATGGGTAGG + Intronic
964660040 3:159110449-159110471 CATTATTTAAATAAATGAAAAGG - Intronic
967139362 3:186541287-186541309 AATAATTGAGATAAATGGGAAGG - Intronic
967225133 3:187283843-187283865 CATTATTTGGGGGAATGGGCCGG + Intronic
967265656 3:187689347-187689369 AATTCTTTTGGTAAATGGGAAGG - Intergenic
969384431 4:6834571-6834593 CATAATTAGGATATATGGCAGGG - Intronic
969489643 4:7491774-7491796 CATTTGTTGGGTAAGTGGGAGGG + Intronic
970366968 4:15369347-15369369 GATTATTTTGATATATAGGAAGG + Intronic
971519998 4:27537629-27537651 AATTATTTGTATACATGGGAAGG + Intergenic
976123771 4:81811189-81811211 TATCATTTGGTCAAATGGGATGG - Intronic
977621658 4:99145005-99145027 CAATATTTTGATAATTGGCATGG - Intronic
979008183 4:115331648-115331670 TAGTATTTGGATATATTGGAAGG - Intergenic
979916329 4:126439022-126439044 CTTTAATTGGTTAAATGTGAGGG + Intergenic
980238700 4:130143804-130143826 CTTTATTTGGGTAAATGCCAAGG + Intergenic
981435390 4:144715035-144715057 CATTCTCTGGATGAAGGGGAGGG + Intronic
982212173 4:153046814-153046836 CTACATTTGGATAAATGGGAAGG - Intergenic
982474054 4:155828426-155828448 CAATATTTGGATAAGTAGGCCGG + Intergenic
984233850 4:177132677-177132699 CATTATTTTTTTAAATGGCATGG - Intergenic
984583367 4:181535315-181535337 CAATATTTGGTGATATGGGAAGG - Intergenic
984596975 4:181680856-181680878 AATTATTTGGATAATTGAGATGG - Intergenic
985064525 4:186107135-186107157 CATTAATTGCATAAATGTTAAGG - Intronic
987005111 5:13702880-13702902 GGTTACTTGGCTAAATGGGAAGG - Intronic
987018760 5:13848092-13848114 AATTATTAGGCTAAATGGAATGG + Intronic
988152831 5:27408550-27408572 CCTCATTTGGATAGATGGGAAGG + Intergenic
989182960 5:38596613-38596635 AATTATGTGGATGAATGGTAAGG - Intronic
990389559 5:55305036-55305058 AATTACTTGGATAACTGGTAAGG - Intronic
991261533 5:64673814-64673836 CATTAAATGGATAAATTGTATGG - Intergenic
994165098 5:96599922-96599944 GATATTTTGGATAAATGAGAAGG - Intronic
994845166 5:104979663-104979685 GATTTTTTGGATTATTGGGATGG - Intergenic
997419848 5:133757087-133757109 CAGGATTTTGCTAAATGGGAGGG - Intergenic
999670236 5:153953280-153953302 TTTTATTTGGATAGATGGAAAGG - Intergenic
1001414509 5:171535422-171535444 GAATATTTGAATAAATGGGAAGG + Intergenic
1001775750 5:174327960-174327982 CCTTATCTGTAAAAATGGGACGG + Intergenic
1002952008 6:1823371-1823393 AGTTATTTGTAAAAATGGGAAGG + Intronic
1006893018 6:37446051-37446073 CAGAAATTGGATAAATGAGAAGG - Intronic
1007016296 6:38470559-38470581 GATCACTAGGATAAATGGGATGG - Intronic
1008520801 6:52361360-52361382 CATTATCTGGAGAAAAGAGAAGG - Intergenic
1009715605 6:67390316-67390338 AATTATTTTGAAAAATGGGAGGG - Intergenic
1010460847 6:76112433-76112455 TATTATTTGGATATAGGTGAGGG + Intergenic
1010786940 6:80014274-80014296 TATTAATTAGAGAAATGGGAAGG - Intronic
1010985419 6:82418198-82418220 CTTTATTTGGATTAATTGAAAGG + Intergenic
1012087141 6:94842538-94842560 CATTGTTTGGAGAAAGGTGAAGG + Intergenic
1013443943 6:110201830-110201852 AAATATTTATATAAATGGGAAGG + Intronic
1013962142 6:115913104-115913126 AAATATTTGTTTAAATGGGATGG - Intergenic
1014061149 6:117073237-117073259 CATTTTTTGGTTATAGGGGAAGG + Intergenic
1015026031 6:128533469-128533491 GATTAGTAGGATAAATCGGATGG + Intergenic
1016334160 6:142986337-142986359 CATAATTTGCATGAAGGGGAGGG - Intergenic
1016563829 6:145429228-145429250 CATTACTTGGTTAGATTGGATGG - Intergenic
1017382015 6:153842252-153842274 CATTATTTGGATAACTACAAGGG + Intergenic
1018315468 6:162552657-162552679 AGTAATTTGGATAAATGAGACGG + Intronic
1018938127 6:168287361-168287383 CCTTCTTTGGATAAAATGGATGG - Intergenic
1027915048 7:84307035-84307057 AATTATTTGGGTAGATGAGAGGG - Intronic
1028820635 7:95207466-95207488 CATTGTTTTTATGAATGGGATGG - Intronic
1028928301 7:96384504-96384526 GAGTCTTTGGTTAAATGGGATGG + Intergenic
1030886839 7:114949237-114949259 CATTATTGGGGGAAATGAGATGG + Intronic
1031410556 7:121436260-121436282 AATTATTTGGATTAAAGGAAAGG - Intergenic
1032955774 7:136970389-136970411 TAGTATTTGAATAAATTGGACGG - Intronic
1037769713 8:21791191-21791213 CATTTTCTGGATAGGTGGGAGGG - Intronic
1038127448 8:24690603-24690625 AATTATCTGGATAAAGGTGATGG + Intergenic
1038593368 8:28861908-28861930 CCTTATTTGTATAGATGAGAAGG + Intronic
1038616621 8:29101574-29101596 CAGTATTTGAGTAAATGAGATGG - Intronic
1038971579 8:32642433-32642455 TATGATTTGGAAAAATGGGAAGG + Intronic
1039653203 8:39366728-39366750 AAATACATGGATAAATGGGATGG + Intergenic
1039713394 8:40082481-40082503 TTTTATTTGCATAAATGTGAAGG + Intergenic
1040004459 8:42607802-42607824 CATTGTTTGGATAAAAGAGATGG + Intergenic
1040700602 8:50059491-50059513 GAGGAATTGGATAAATGGGAGGG - Intronic
1041525653 8:58802483-58802505 CATTGCTTGGAGAAAGGGGATGG - Intergenic
1041721511 8:60980487-60980509 CTTTATTTGGAAAAAGGGGCCGG + Intergenic
1041840810 8:62268550-62268572 CAATATTTCAATAAGTGGGAAGG + Intronic
1043646734 8:82530696-82530718 GATGATGTGGATAAATAGGAAGG - Intergenic
1043679610 8:83006408-83006430 CAGCATTTGGAAAAAAGGGAAGG + Intergenic
1044790536 8:95842425-95842447 CCATATATGGATACATGGGATGG + Intergenic
1049282889 8:141759496-141759518 CATTATTTAGAGAAAGAGGAAGG + Intergenic
1050936668 9:11405394-11405416 AATTATTTTGAGAAATGTGAAGG + Intergenic
1052419026 9:28217951-28217973 CATAATTTGGAAAAAGAGGAGGG + Intronic
1054869668 9:70037850-70037872 CAGTATTTGGAAACATGGAAAGG - Intergenic
1054922974 9:70560244-70560266 TATTTTTTGGATATATGGAATGG - Intronic
1057182817 9:93039048-93039070 CATCATTTGGATTTCTGGGACGG + Intergenic
1057520584 9:95756883-95756905 CATTATTTACATATTTGGGAAGG + Intergenic
1058470895 9:105277743-105277765 CACTACTTGGTTACATGGGAAGG - Intronic
1062089697 9:134669015-134669037 GAGTAAATGGATAAATGGGATGG - Intronic
1202629087 M:1720-1742 CTTTATTTGGGTAAATGGTTTGG - Intergenic
1185537690 X:875320-875342 CATTATTAAGATAAATTGCAGGG - Intergenic
1186840838 X:13483559-13483581 CTGTATTTGGATAAATGGGGTGG - Intergenic
1187766465 X:22647963-22647985 TATCATTTGGATAGATGGAAAGG - Intergenic
1187781889 X:22836455-22836477 AATAACTTGAATAAATGGGAAGG - Intergenic
1188582370 X:31729530-31729552 CATTATTTTTATAAATGTGAGGG + Intronic
1189103845 X:38217388-38217410 CAGAATTTGGACAAATGGCAAGG + Intronic
1190869353 X:54412170-54412192 CTTTATCTGGAGGAATGGGAAGG - Intergenic
1191887586 X:65904681-65904703 CATCATTTGGATATCTGGAAAGG + Intergenic
1193935890 X:87620916-87620938 CATTATTTGTATAAGTGGGAGGG + Intronic
1193972294 X:88069429-88069451 ATTAATTTGGATAAATGAGAGGG + Intergenic
1197401238 X:125993611-125993633 TTTTATTTGTATAAATGTGAGGG - Intergenic
1197636389 X:128919499-128919521 CATTATATGGGGAAATGGAAAGG + Intergenic
1199141166 X:144314472-144314494 CAATATTTGGATAACTGGCCAGG - Intergenic