ID: 1097383959

View in Genome Browser
Species Human (GRCh38)
Location 12:58927277-58927299
Sequence GGCACAACTGTGACTACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097383954_1097383959 -1 Left 1097383954 12:58927255-58927277 CCTCACTCATCTGCTTGCCCCAG No data
Right 1097383959 12:58927277-58927299 GGCACAACTGTGACTACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097383959 Original CRISPR GGCACAACTGTGACTACAGC AGG Intergenic
No off target data available for this crispr