ID: 1097384488

View in Genome Browser
Species Human (GRCh38)
Location 12:58933508-58933530
Sequence CCCTATCCACAGGTGTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097384480_1097384488 5 Left 1097384480 12:58933480-58933502 CCACTCCACCAGGGAACTGCCAT No data
Right 1097384488 12:58933508-58933530 CCCTATCCACAGGTGTCCCATGG No data
1097384479_1097384488 6 Left 1097384479 12:58933479-58933501 CCCACTCCACCAGGGAACTGCCA No data
Right 1097384488 12:58933508-58933530 CCCTATCCACAGGTGTCCCATGG No data
1097384482_1097384488 0 Left 1097384482 12:58933485-58933507 CCACCAGGGAACTGCCATGGTGG No data
Right 1097384488 12:58933508-58933530 CCCTATCCACAGGTGTCCCATGG No data
1097384484_1097384488 -3 Left 1097384484 12:58933488-58933510 CCAGGGAACTGCCATGGTGGCCC No data
Right 1097384488 12:58933508-58933530 CCCTATCCACAGGTGTCCCATGG No data
1097384475_1097384488 15 Left 1097384475 12:58933470-58933492 CCCAGCAGACCCACTCCACCAGG No data
Right 1097384488 12:58933508-58933530 CCCTATCCACAGGTGTCCCATGG No data
1097384477_1097384488 14 Left 1097384477 12:58933471-58933493 CCAGCAGACCCACTCCACCAGGG No data
Right 1097384488 12:58933508-58933530 CCCTATCCACAGGTGTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097384488 Original CRISPR CCCTATCCACAGGTGTCCCA TGG Intergenic
No off target data available for this crispr