ID: 1097386553

View in Genome Browser
Species Human (GRCh38)
Location 12:58956725-58956747
Sequence TGATTTATATTTTCACTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097386553_1097386558 16 Left 1097386553 12:58956725-58956747 CCCTTAAGTGAAAATATAAATCA No data
Right 1097386558 12:58956764-58956786 CTTTATTCTTTGTCTTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097386553 Original CRISPR TGATTTATATTTTCACTTAA GGG (reversed) Intergenic
No off target data available for this crispr