ID: 1097387049

View in Genome Browser
Species Human (GRCh38)
Location 12:58962490-58962512
Sequence CAGGCTAAAAACTATCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097387043_1097387049 5 Left 1097387043 12:58962462-58962484 CCAGAAGGTGAAAGTGAGGGAAG No data
Right 1097387049 12:58962490-58962512 CAGGCTAAAAACTATCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097387049 Original CRISPR CAGGCTAAAAACTATCTAGT GGG Intergenic
No off target data available for this crispr