ID: 1097397603

View in Genome Browser
Species Human (GRCh38)
Location 12:59094675-59094697
Sequence CCTGCAAACCCTGTGTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097397603_1097397607 -9 Left 1097397603 12:59094675-59094697 CCTCACAACACAGGGTTTGCAGG No data
Right 1097397607 12:59094689-59094711 GTTTGCAGGTGTTGTTTCTGGGG No data
1097397603_1097397609 7 Left 1097397603 12:59094675-59094697 CCTCACAACACAGGGTTTGCAGG No data
Right 1097397609 12:59094705-59094727 TCTGGGGAGGCAACACCTAAAGG No data
1097397603_1097397608 -6 Left 1097397603 12:59094675-59094697 CCTCACAACACAGGGTTTGCAGG No data
Right 1097397608 12:59094692-59094714 TGCAGGTGTTGTTTCTGGGGAGG No data
1097397603_1097397606 -10 Left 1097397603 12:59094675-59094697 CCTCACAACACAGGGTTTGCAGG No data
Right 1097397606 12:59094688-59094710 GGTTTGCAGGTGTTGTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097397603 Original CRISPR CCTGCAAACCCTGTGTTGTG AGG (reversed) Intergenic
No off target data available for this crispr