ID: 1097399390

View in Genome Browser
Species Human (GRCh38)
Location 12:59110511-59110533
Sequence GCCATTATCTTGAAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097399390_1097399394 -8 Left 1097399390 12:59110511-59110533 CCGTCCTCCTTCAAGATAATGGC No data
Right 1097399394 12:59110526-59110548 ATAATGGCCTAGGACCAAGATGG No data
1097399390_1097399401 11 Left 1097399390 12:59110511-59110533 CCGTCCTCCTTCAAGATAATGGC No data
Right 1097399401 12:59110545-59110567 ATGGTGCTACAGGAGGGACAGGG No data
1097399390_1097399398 5 Left 1097399390 12:59110511-59110533 CCGTCCTCCTTCAAGATAATGGC No data
Right 1097399398 12:59110539-59110561 ACCAAGATGGTGCTACAGGAGGG No data
1097399390_1097399402 19 Left 1097399390 12:59110511-59110533 CCGTCCTCCTTCAAGATAATGGC No data
Right 1097399402 12:59110553-59110575 ACAGGAGGGACAGGGAAGTAAGG No data
1097399390_1097399397 4 Left 1097399390 12:59110511-59110533 CCGTCCTCCTTCAAGATAATGGC No data
Right 1097399397 12:59110538-59110560 GACCAAGATGGTGCTACAGGAGG No data
1097399390_1097399400 10 Left 1097399390 12:59110511-59110533 CCGTCCTCCTTCAAGATAATGGC No data
Right 1097399400 12:59110544-59110566 GATGGTGCTACAGGAGGGACAGG No data
1097399390_1097399396 1 Left 1097399390 12:59110511-59110533 CCGTCCTCCTTCAAGATAATGGC No data
Right 1097399396 12:59110535-59110557 TAGGACCAAGATGGTGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097399390 Original CRISPR GCCATTATCTTGAAGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr