ID: 1097399394

View in Genome Browser
Species Human (GRCh38)
Location 12:59110526-59110548
Sequence ATAATGGCCTAGGACCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097399390_1097399394 -8 Left 1097399390 12:59110511-59110533 CCGTCCTCCTTCAAGATAATGGC No data
Right 1097399394 12:59110526-59110548 ATAATGGCCTAGGACCAAGATGG No data
1097399387_1097399394 13 Left 1097399387 12:59110490-59110512 CCAGTCAGTAGTCTGTGGCCACC No data
Right 1097399394 12:59110526-59110548 ATAATGGCCTAGGACCAAGATGG No data
1097399388_1097399394 -5 Left 1097399388 12:59110508-59110530 CCACCGTCCTCCTTCAAGATAAT No data
Right 1097399394 12:59110526-59110548 ATAATGGCCTAGGACCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097399394 Original CRISPR ATAATGGCCTAGGACCAAGA TGG Intergenic
No off target data available for this crispr