ID: 1097399400

View in Genome Browser
Species Human (GRCh38)
Location 12:59110544-59110566
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097399388_1097399400 13 Left 1097399388 12:59110508-59110530 CCACCGTCCTCCTTCAAGATAAT No data
Right 1097399400 12:59110544-59110566 GATGGTGCTACAGGAGGGACAGG No data
1097399390_1097399400 10 Left 1097399390 12:59110511-59110533 CCGTCCTCCTTCAAGATAATGGC No data
Right 1097399400 12:59110544-59110566 GATGGTGCTACAGGAGGGACAGG No data
1097399393_1097399400 3 Left 1097399393 12:59110518-59110540 CCTTCAAGATAATGGCCTAGGAC No data
Right 1097399400 12:59110544-59110566 GATGGTGCTACAGGAGGGACAGG No data
1097399391_1097399400 6 Left 1097399391 12:59110515-59110537 CCTCCTTCAAGATAATGGCCTAG No data
Right 1097399400 12:59110544-59110566 GATGGTGCTACAGGAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097399400 Original CRISPR GATGGTGCTACAGGAGGGAC AGG Intergenic
No off target data available for this crispr