ID: 1097400513

View in Genome Browser
Species Human (GRCh38)
Location 12:59123017-59123039
Sequence TGGAAATTCCAGGATCTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097400509_1097400513 -2 Left 1097400509 12:59122996-59123018 CCTTTTGCCTTACAAAAACACTG No data
Right 1097400513 12:59123017-59123039 TGGAAATTCCAGGATCTAATTGG No data
1097400508_1097400513 -1 Left 1097400508 12:59122995-59123017 CCCTTTTGCCTTACAAAAACACT No data
Right 1097400513 12:59123017-59123039 TGGAAATTCCAGGATCTAATTGG No data
1097400507_1097400513 8 Left 1097400507 12:59122986-59123008 CCAACTTGACCCTTTTGCCTTAC No data
Right 1097400513 12:59123017-59123039 TGGAAATTCCAGGATCTAATTGG No data
1097400511_1097400513 -9 Left 1097400511 12:59123003-59123025 CCTTACAAAAACACTGGAAATTC No data
Right 1097400513 12:59123017-59123039 TGGAAATTCCAGGATCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097400513 Original CRISPR TGGAAATTCCAGGATCTAAT TGG Intergenic
No off target data available for this crispr