ID: 1097404239

View in Genome Browser
Species Human (GRCh38)
Location 12:59169659-59169681
Sequence AAATAGCAGTTGCTTCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097404239_1097404244 22 Left 1097404239 12:59169659-59169681 CCAGAAAGAAGCAACTGCTATTT No data
Right 1097404244 12:59169704-59169726 AACACCCTGGAAAATCAAGGTGG No data
1097404239_1097404242 9 Left 1097404239 12:59169659-59169681 CCAGAAAGAAGCAACTGCTATTT No data
Right 1097404242 12:59169691-59169713 AAATAGGTAGGTGAACACCCTGG No data
1097404239_1097404240 -7 Left 1097404239 12:59169659-59169681 CCAGAAAGAAGCAACTGCTATTT No data
Right 1097404240 12:59169675-59169697 GCTATTTTTCTGCTGTAAATAGG No data
1097404239_1097404243 19 Left 1097404239 12:59169659-59169681 CCAGAAAGAAGCAACTGCTATTT No data
Right 1097404243 12:59169701-59169723 GTGAACACCCTGGAAAATCAAGG No data
1097404239_1097404241 -3 Left 1097404239 12:59169659-59169681 CCAGAAAGAAGCAACTGCTATTT No data
Right 1097404241 12:59169679-59169701 TTTTTCTGCTGTAAATAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097404239 Original CRISPR AAATAGCAGTTGCTTCTTTC TGG (reversed) Intergenic
No off target data available for this crispr