ID: 1097404243

View in Genome Browser
Species Human (GRCh38)
Location 12:59169701-59169723
Sequence GTGAACACCCTGGAAAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097404239_1097404243 19 Left 1097404239 12:59169659-59169681 CCAGAAAGAAGCAACTGCTATTT No data
Right 1097404243 12:59169701-59169723 GTGAACACCCTGGAAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097404243 Original CRISPR GTGAACACCCTGGAAAATCA AGG Intergenic
No off target data available for this crispr