ID: 1097408051

View in Genome Browser
Species Human (GRCh38)
Location 12:59215444-59215466
Sequence CTGACAGTCTGTAAGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097408046_1097408051 -2 Left 1097408046 12:59215423-59215445 CCATTAAGGGTAAGCTCCTGCCT No data
Right 1097408051 12:59215444-59215466 CTGACAGTCTGTAAGGAAATGGG No data
1097408045_1097408051 3 Left 1097408045 12:59215418-59215440 CCTGGCCATTAAGGGTAAGCTCC No data
Right 1097408051 12:59215444-59215466 CTGACAGTCTGTAAGGAAATGGG No data
1097408041_1097408051 19 Left 1097408041 12:59215402-59215424 CCACAGGCAGAAGTTCCCTGGCC No data
Right 1097408051 12:59215444-59215466 CTGACAGTCTGTAAGGAAATGGG No data
1097408044_1097408051 4 Left 1097408044 12:59215417-59215439 CCCTGGCCATTAAGGGTAAGCTC No data
Right 1097408051 12:59215444-59215466 CTGACAGTCTGTAAGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097408051 Original CRISPR CTGACAGTCTGTAAGGAAAT GGG Intergenic
No off target data available for this crispr