ID: 1097416102

View in Genome Browser
Species Human (GRCh38)
Location 12:59318239-59318261
Sequence TATCATTAACCATTAATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097416102_1097416104 23 Left 1097416102 12:59318239-59318261 CCTCTAATTAATGGTTAATGATA No data
Right 1097416104 12:59318285-59318307 TTCTATCTATATATCCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097416102 Original CRISPR TATCATTAACCATTAATTAG AGG (reversed) Intergenic
No off target data available for this crispr