ID: 1097417503

View in Genome Browser
Species Human (GRCh38)
Location 12:59329873-59329895
Sequence CTAGATATACAGATCAGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097417500_1097417503 30 Left 1097417500 12:59329820-59329842 CCATGTTTGCAGGGATTTTCTGA No data
Right 1097417503 12:59329873-59329895 CTAGATATACAGATCAGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097417503 Original CRISPR CTAGATATACAGATCAGTCT AGG Intergenic
No off target data available for this crispr