ID: 1097426140

View in Genome Browser
Species Human (GRCh38)
Location 12:59446707-59446729
Sequence AGACAGAGCACAGTGATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097426140_1097426146 28 Left 1097426140 12:59446707-59446729 CCCAGAATCACTGTGCTCTGTCT No data
Right 1097426146 12:59446758-59446780 TGCCATGCAACCTCTGCTCAGGG No data
1097426140_1097426147 29 Left 1097426140 12:59446707-59446729 CCCAGAATCACTGTGCTCTGTCT No data
Right 1097426147 12:59446759-59446781 GCCATGCAACCTCTGCTCAGGGG No data
1097426140_1097426145 27 Left 1097426140 12:59446707-59446729 CCCAGAATCACTGTGCTCTGTCT No data
Right 1097426145 12:59446757-59446779 ATGCCATGCAACCTCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097426140 Original CRISPR AGACAGAGCACAGTGATTCT GGG (reversed) Intergenic
No off target data available for this crispr