ID: 1097430045

View in Genome Browser
Species Human (GRCh38)
Location 12:59494163-59494185
Sequence TTGAGGCTTTTATCTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097430045_1097430049 4 Left 1097430045 12:59494163-59494185 CCAGGAGAAGATAAAAGCCTCAA No data
Right 1097430049 12:59494190-59494212 GAAATCTGGACATTAGTGGTAGG No data
1097430045_1097430048 0 Left 1097430045 12:59494163-59494185 CCAGGAGAAGATAAAAGCCTCAA No data
Right 1097430048 12:59494186-59494208 AGCTGAAATCTGGACATTAGTGG No data
1097430045_1097430046 -10 Left 1097430045 12:59494163-59494185 CCAGGAGAAGATAAAAGCCTCAA No data
Right 1097430046 12:59494176-59494198 AAAGCCTCAAAGCTGAAATCTGG No data
1097430045_1097430050 21 Left 1097430045 12:59494163-59494185 CCAGGAGAAGATAAAAGCCTCAA No data
Right 1097430050 12:59494207-59494229 GGTAGGTAGCAAAATAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097430045 Original CRISPR TTGAGGCTTTTATCTTCTCC TGG (reversed) Intergenic
No off target data available for this crispr