ID: 1097430048

View in Genome Browser
Species Human (GRCh38)
Location 12:59494186-59494208
Sequence AGCTGAAATCTGGACATTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097430045_1097430048 0 Left 1097430045 12:59494163-59494185 CCAGGAGAAGATAAAAGCCTCAA No data
Right 1097430048 12:59494186-59494208 AGCTGAAATCTGGACATTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097430048 Original CRISPR AGCTGAAATCTGGACATTAG TGG Intergenic
No off target data available for this crispr