ID: 1097432054

View in Genome Browser
Species Human (GRCh38)
Location 12:59521845-59521867
Sequence CAACTTTTCTAAAGGTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 337}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097432054 Original CRISPR CAACTTTTCTAAAGGTCAGT GGG (reversed) Intergenic
905987183 1:42296590-42296612 CAACTTTGTCAAAGATCAGTTGG + Intronic
906001005 1:42424887-42424909 CTTCTTTTCTTAAGGTCAGATGG + Intergenic
906875734 1:49536760-49536782 CATCTTTTTAAAAGATCAGTTGG - Intronic
906879122 1:49570869-49570891 CAACTTTTTCAAAGATCAGTTGG + Intronic
907263466 1:53239132-53239154 CACCTATTCTAGAGATCAGTGGG - Intergenic
908537799 1:65094340-65094362 CAACTTTGCTGAAGATCAGTTGG + Intergenic
908861112 1:68490891-68490913 CAGCTTTGCTGAAGATCAGTTGG - Intronic
909355607 1:74705916-74705938 GAACCTTTATAAAGGTAAGTAGG + Exonic
909836729 1:80264498-80264520 CAACTTTGTTGAAGGTCAGATGG - Intergenic
910442313 1:87265485-87265507 CAATATTTCTTAAGGTCAGGAGG + Intergenic
910739068 1:90495053-90495075 CAACTGTTATAAAGTTCAGCTGG + Intergenic
910903432 1:92147739-92147761 CAACTTTTCTGAATCTCAGGAGG - Exonic
911034426 1:93525649-93525671 CAATTGTTCTAAAGGCAAGTTGG - Intronic
914014962 1:143810382-143810404 CAACTTTGTTAAAGATCAGTTGG - Intergenic
914162861 1:145150837-145150859 CAACTTTGTTAAAGATCAGTTGG + Intergenic
914653580 1:149718921-149718943 CAACTTTGTTAAAGATCAGTTGG - Intergenic
917017933 1:170555701-170555723 CATCATTTATAAAGGTCACTGGG - Intergenic
917066061 1:171094721-171094743 CAACTTTGCTGAAGATCAGTTGG + Intronic
918950538 1:191130758-191130780 AAACTATTCTAAAGTTCATTTGG + Intergenic
919041274 1:192391380-192391402 CAACTTTGTTAAAGATCAGTTGG - Intergenic
919321114 1:196039663-196039685 AATGTTCTCTAAAGGTCAGTTGG + Intergenic
919435542 1:197555040-197555062 CAATTTTGTTAAAGATCAGTTGG - Intronic
922015810 1:221645507-221645529 GAACTTTCCTCAAGCTCAGTGGG + Intergenic
922917232 1:229268871-229268893 CCACTTTTTTCCAGGTCAGTGGG - Intergenic
924505129 1:244675562-244675584 CACCTTTGTTAAAGATCAGTTGG + Intronic
1064991465 10:21260288-21260310 CCACTTTTCCAAAGGCCAGAAGG + Intergenic
1065040475 10:21689326-21689348 CAACTTCTTTAATGGTCAGTAGG + Intronic
1066070213 10:31800973-31800995 CTACATTTCGAATGGTCAGTGGG - Intergenic
1066184885 10:32999679-32999701 CAACTTTGTCAAAGGTCAGATGG + Intronic
1066473053 10:35717940-35717962 CAACTTTTATCAATGTCATTTGG - Intergenic
1066597886 10:37072195-37072217 CAACTTTATTAAAAATCAGTTGG + Intergenic
1067493769 10:46742284-46742306 CAATTTTGTTAAAGATCAGTTGG + Intergenic
1067600890 10:47598121-47598143 CAATTTTGTTAAAGATCAGTTGG - Intergenic
1068381388 10:56257934-56257956 CAACTTTGTAAAAGATCAGTTGG + Intergenic
1069068291 10:63968896-63968918 AAACTATTCTAAAGTTCAGATGG + Intergenic
1069119386 10:64550149-64550171 CTTATTTTTTAAAGGTCAGTTGG + Intergenic
1069274905 10:66577609-66577631 CAACTCTGCTAAAGGACAGGTGG + Intronic
1071040469 10:81302963-81302985 CAACTTTACCAAAGGTCAGATGG - Intergenic
1071440930 10:85693642-85693664 TGACTTTGCTAAAGATCAGTTGG - Intronic
1071652432 10:87405988-87406010 CAATTTTGTTAAAGATCAGTTGG - Intergenic
1071924182 10:90386680-90386702 CAACTTCTTTGAAGATCAGTTGG - Intergenic
1072090774 10:92125140-92125162 AAACTTTTCTAAAAGTGGGTGGG + Intronic
1072207629 10:93218569-93218591 CAACTTTGTCAAAGGTCAGATGG - Intergenic
1072832881 10:98677641-98677663 CAAATCTACTAAAGGTCAGAGGG + Intronic
1073430045 10:103480006-103480028 CGAATTTTGTAAAGGTCACTTGG + Intergenic
1075449506 10:122539882-122539904 CTACATTTCAAAAAGTCAGTTGG - Intergenic
1077458601 11:2696514-2696536 CTCCTTTTCAAAAGTTCAGTTGG + Intronic
1079622342 11:22569108-22569130 CAACTTTGTCAAAGGTCAGATGG - Intergenic
1080131402 11:28799379-28799401 CAACTTTTCCCAAGTTCAGATGG - Intergenic
1081053428 11:38375725-38375747 CAACTTTGTTTAATGTCAGTTGG + Intergenic
1081304124 11:41490679-41490701 CAACTTTATCAAAGATCAGTTGG - Intergenic
1082880510 11:58032474-58032496 CAGCTTTTTCAAAGATCAGTTGG - Intronic
1085891923 11:80590159-80590181 CAATTTTGTTAAAAGTCAGTTGG - Intergenic
1086195654 11:84135776-84135798 GAATTTATCTAAAAGTCAGTGGG + Intronic
1086616289 11:88824493-88824515 CAATTTTTCCACAGGACAGTGGG + Intronic
1086616980 11:88832823-88832845 CAACTTTTCCAAAAATCATTTGG - Intronic
1086788972 11:91010347-91010369 TAACTTTCTCAAAGGTCAGTTGG - Intergenic
1086996695 11:93365987-93366009 CAACTTGCCTAAAGGTCACAGGG - Intronic
1087654841 11:100909812-100909834 CAACTTTTTCAAAGATCAGTTGG + Intronic
1087945049 11:104149271-104149293 CAACTTTATTATAGGTTAGTTGG + Intronic
1088112148 11:106274614-106274636 CAACTTTGTTGAAGATCAGTTGG + Intergenic
1088165612 11:106932825-106932847 CAACTTTGCTGAAGATCAGATGG - Intronic
1088392747 11:109333582-109333604 CAAATCTTCTTAAGGTCAGTAGG - Intergenic
1089713338 11:120333737-120333759 CAACATTTCTACAGGTCAAAAGG - Intergenic
1090499786 11:127250313-127250335 CCACTTTCCCAAAGGACAGTTGG - Intergenic
1090589757 11:128252783-128252805 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1091245333 11:134088953-134088975 CAACATTTATTAAGGGCAGTCGG + Intronic
1093471052 12:19502567-19502589 CAACTTTTTTGAAGATCAGTTGG + Intronic
1094196892 12:27759185-27759207 CAATTTATCTAATGGTCAGAAGG + Intergenic
1094352955 12:29546641-29546663 CATTTTTTCTAAAGCCCAGTAGG - Intronic
1095541999 12:43320945-43320967 CAAAGGTTCTAAAGATCAGTAGG - Intergenic
1096427597 12:51517223-51517245 AAACTCCTCTGAAGGTCAGTGGG + Intergenic
1097432054 12:59521845-59521867 CAACTTTTCTAAAGGTCAGTGGG - Intergenic
1097729810 12:63115892-63115914 CAACTTTGTTGAAGATCAGTTGG - Intergenic
1098504985 12:71238908-71238930 CACCTTTTCTATAGGTCAGTGGG + Intronic
1098621107 12:72600026-72600048 CAACTTTGTTAAAGATCAGATGG + Intronic
1099335436 12:81350815-81350837 AAACTATTCTAAAGTGCAGTAGG + Intronic
1100928538 12:99579056-99579078 CAACTTTTTTGAAGATCAGTTGG - Intronic
1101180276 12:102209210-102209232 CAACTTTGATGAAGGTCAGGTGG - Intergenic
1104413015 12:128574926-128574948 CCCCTTTTCTAGGGGTCAGTAGG + Intronic
1104956540 12:132469319-132469341 CGCCTTTGCTGAAGGTCAGTTGG - Intergenic
1106143573 13:27032488-27032510 CACCTTTTAAAAAAGTCAGTTGG - Intergenic
1106304497 13:28497300-28497322 CAACTTTTCAAAAGAGTAGTTGG - Intergenic
1109380727 13:61556660-61556682 CAACTTTTTAAAAAGTCATTTGG + Intergenic
1109696586 13:65968388-65968410 CAACTTTGTCAAAGATCAGTTGG + Intergenic
1109715253 13:66213383-66213405 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1109877271 13:68421777-68421799 CAACTTTGTTGAAGATCAGTTGG + Intergenic
1110083608 13:71348000-71348022 CAACTTTTCTAAATGGCTGCAGG + Intergenic
1110671133 13:78179367-78179389 CAACTTTATTGAAGTTCAGTTGG + Intergenic
1111064327 13:83071406-83071428 CAACTTTTTCAAAGATCAGGTGG + Intergenic
1111120059 13:83836070-83836092 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1111423923 13:88054289-88054311 CAGCTTTGCCAAAGATCAGTTGG + Intergenic
1112715099 13:102175301-102175323 CAACTTTTCCAAAGATCAGTTGG - Intronic
1114224725 14:20727045-20727067 CCCCCTTTCTAAATGTCAGTGGG - Intergenic
1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG + Intergenic
1115778616 14:36744395-36744417 CAACTTTGTCAAAGATCAGTTGG - Intronic
1116108103 14:40537835-40537857 CAACTTTGTCAAATGTCAGTTGG - Intergenic
1116300976 14:43182666-43182688 TAACTTTTCTGAAAGTCTGTTGG - Intergenic
1116369888 14:44116913-44116935 CAACTTTGTCAAAGATCAGTTGG + Intergenic
1116782892 14:49255763-49255785 CAACTTTGTTGAAGATCAGTTGG - Intergenic
1116796646 14:49398291-49398313 CAACTTTGTTGAAGATCAGTTGG - Intergenic
1116882381 14:50184639-50184661 CCAATTTTTTAGAGGTCAGTGGG - Intronic
1117132995 14:52704934-52704956 CAATTTTTCTAAATGTGACTGGG - Intergenic
1117166408 14:53038683-53038705 CAACTATTCTAAAATTCAGATGG + Intronic
1117827375 14:59717796-59717818 CAACTTTTTCCAAGGCCAGTTGG - Intronic
1120010584 14:79408958-79408980 TAACTATTCTAATGGCCAGTAGG - Intronic
1126270064 15:46805446-46805468 CAACTTTGTTGAAGATCAGTTGG - Intergenic
1126467042 15:48970518-48970540 CAACTTTGTTAAAGATCAGATGG - Intergenic
1126796217 15:52262163-52262185 CAGCTTTTCAAAAAGTCAGATGG + Intronic
1127110001 15:55658708-55658730 CAACTTTTCTAGGGGTAATTGGG - Intronic
1128936595 15:71751084-71751106 GTCCTTTTCTAAAGGACAGTGGG - Intronic
1128967158 15:72070761-72070783 CAACTTTATTGAAGATCAGTTGG - Intronic
1132260072 15:100416340-100416362 CAACTTTGTTGAAGGTCAGATGG - Intronic
1132774685 16:1586487-1586509 CAGCTTTCCTAGAGGCCAGTTGG + Intronic
1133122998 16:3623200-3623222 CAACTTTATTGAAGATCAGTTGG - Intronic
1135330925 16:21559000-21559022 CATCTTTTGAAAATGTCAGTGGG - Intergenic
1136668433 16:31835856-31835878 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1136670678 16:31854353-31854375 CATTTTTTCATAAGGTCAGTTGG - Intergenic
1137046672 16:35670284-35670306 CAATTTTTTTCAAGGTCATTTGG - Intergenic
1137418426 16:48308197-48308219 CTACTTTGCCAAAGATCAGTTGG - Intronic
1138546729 16:57723979-57724001 GAACTTTTCTGGAGGACAGTTGG + Intronic
1140028627 16:71315429-71315451 CAAGCTTTCTCAAGGTCAGCTGG - Intergenic
1140438753 16:74970174-74970196 CAACTTTGTCAAAGATCAGTTGG + Intronic
1143188789 17:5026304-5026326 CAAGTTTTCTGGAGGTCAGAGGG + Exonic
1146741979 17:35294298-35294320 CAACTTTGCCAAAGATCAGTTGG - Intergenic
1149364584 17:55929935-55929957 CAACTTTGCCAAAGATCAGATGG - Intergenic
1150509184 17:65731116-65731138 CAAGTTATCTAAATGTGAGTTGG - Intronic
1151228002 17:72660935-72660957 CATGTTTACTCAAGGTCAGTGGG - Intronic
1153995728 18:10440023-10440045 CATCTTCTCTAAAGCTCAGAAGG - Intergenic
1154059046 18:11041509-11041531 CATTGTTTGTAAAGGTCAGTGGG + Intronic
1154928974 18:20972717-20972739 CAACTCTTCTCAAGGTCAGTGGG - Intronic
1155887550 18:31226402-31226424 CAACTTTTATAAAAGGTAGTTGG + Intergenic
1156213507 18:34973604-34973626 CAGCTTTTTCAAAGATCAGTTGG - Intergenic
1158749930 18:60246882-60246904 CAACTTTTCTTAAGAGCATTTGG + Intergenic
1158793766 18:60815856-60815878 CAACTTTGTCAAAGGTCAGATGG - Intergenic
1159170704 18:64762691-64762713 CAACTTTGTTAAAGATCAGATGG - Intergenic
1160552865 18:79706177-79706199 CAACTTGGCTGCAGGTCAGTGGG - Intronic
1160606450 18:80053908-80053930 CAACTTTATCAAAGATCAGTTGG - Intronic
1164685467 19:30163708-30163730 CATCGTTTCAAAAGGTCAGCTGG + Intergenic
1165099126 19:33428172-33428194 CGAATTTTCTAAATTTCAGTGGG - Intronic
1165099456 19:33430231-33430253 CAACTTTTCTAGATGGCACTGGG + Intronic
1165691955 19:37870512-37870534 AAAATTTTCTAAATGGCAGTTGG + Intergenic
926263575 2:11292065-11292087 TAACTTTTCTAAAGGCTATTTGG + Intronic
926501493 2:13659041-13659063 CAACCTTTTTGAAGATCAGTTGG + Intergenic
926891536 2:17643453-17643475 CAACCCTTCTACTGGTCAGTGGG + Intronic
929201242 2:39239051-39239073 CAACTTTGTCAAAAGTCAGTTGG - Intergenic
929956095 2:46459926-46459948 GAACATTTCTAAGGGACAGTGGG - Intronic
931519962 2:63085013-63085035 CAACTTTGTTGAAGATCAGTTGG + Intergenic
931919517 2:66998149-66998171 CAACTTTATCAAAGATCAGTTGG + Intergenic
932120274 2:69092575-69092597 CAATTTATTTAAAGGTCAGTAGG - Intronic
933327713 2:80859906-80859928 AAATTTTTTTAAAGGTTAGTAGG - Intergenic
935440555 2:103090303-103090325 CAACTTTGTTGAAGATCAGTTGG + Intergenic
936023996 2:109017276-109017298 CAACTTTTCCAAAGCTCTGGGGG + Intergenic
936479957 2:112877044-112877066 CAACTTTTCCAAATGACAATGGG + Intergenic
937137450 2:119566267-119566289 CAACTCTACTAAAAGTGAGTCGG + Intronic
937737992 2:125314390-125314412 TACATTTTCTAAAGGTCTGTAGG + Intergenic
937754584 2:125521124-125521146 CAACTTTGTTGAAGATCAGTTGG - Intergenic
939089465 2:137762034-137762056 CAACTTTGCCAAAGATCAGATGG - Intergenic
940500007 2:154481905-154481927 AAATGTTTCTAAAGGTCATTTGG + Intergenic
940501646 2:154501471-154501493 CAACTTTGTCAAAGATCAGTTGG + Intergenic
940534005 2:154915210-154915232 CAAAGTTTCTACAGGGCAGTAGG + Intergenic
940749316 2:157607096-157607118 CAGCTTTTTTGAAGATCAGTTGG + Intronic
940754726 2:157669212-157669234 AATCATTTCTAAAGGTCAGCCGG - Intergenic
942762451 2:179415616-179415638 CAACTTTGTCAAAGATCAGTTGG - Intergenic
942833958 2:180269843-180269865 CAACTTTGCCAAAGATCAGAAGG + Intergenic
943141538 2:183988993-183989015 CAACTTTGCCAAAGATCAGATGG + Intergenic
943270240 2:185791926-185791948 CAAAATTTCTAAATGTCCGTTGG - Exonic
943391181 2:187270172-187270194 CAACTTTACTGATGATCAGTTGG + Intergenic
943700781 2:190986383-190986405 CACCTTTTCTCCAGGGCAGTAGG - Intronic
945404414 2:209426875-209426897 CAAATTTTCTAAACATCAGAAGG + Intronic
945669331 2:212784420-212784442 CACCTTTGCCAAAGATCAGTTGG - Intergenic
1169506003 20:6212677-6212699 CAACTTTGTCAAAGGTCAGTTGG - Intergenic
1170406501 20:16043510-16043532 TAAATTTTCCAAGGGTCAGTAGG - Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1170953870 20:20960934-20960956 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1173864404 20:46305218-46305240 CAACTTTTCATCAGGGCAGTGGG - Intronic
1174148141 20:48466864-48466886 CAACCTTTCTAGAGGGCAATTGG - Intergenic
1174575137 20:51531945-51531967 CACATTTTCTGAAGGTCAGCAGG - Intronic
1175613900 20:60375960-60375982 CTACTGTTCGATAGGTCAGTAGG + Intergenic
1175615617 20:60395633-60395655 CAACTTTTCTAAATGTCTGCTGG - Intergenic
1177028739 21:15955113-15955135 CACCTTTTCATAAAGTCAGTTGG + Intergenic
1177140140 21:17349413-17349435 CAGCTTTGCTAAAAATCAGTTGG + Intergenic
1177450861 21:21263715-21263737 CAACTTTGAGAAAGATCAGTTGG - Intronic
1181647115 22:24237806-24237828 CAACTTTTAAAAAGGTCCATAGG + Intronic
1183127558 22:35799241-35799263 ATACTTTTCTAAATGGCAGTGGG - Intronic
1185022446 22:48386476-48386498 CAGCTTTGCTAAAGATCAGATGG - Intergenic
1185263969 22:49888308-49888330 CAACTTTTCTAAAAGGTCGTAGG - Exonic
949264717 3:2143047-2143069 CGATTTTTCTCAAGGTCACTGGG + Intronic
949950630 3:9225889-9225911 CAGCTTTTATAAAAGTCAGAAGG - Intronic
951082584 3:18469268-18469290 CAACATCTCAAAAGATCAGTTGG - Intergenic
951422889 3:22509024-22509046 CAACATTTTGAGAGGTCAGTGGG + Intergenic
951777965 3:26331017-26331039 CAACTTTGTTAAATATCAGTTGG - Intergenic
951829021 3:26903216-26903238 TAACTTTGTTGAAGGTCAGTTGG - Intergenic
952706448 3:36381925-36381947 CAACTTTTCTAAAACTCGGTTGG + Intronic
952728256 3:36612542-36612564 CAACTTTGCCAAAGATCAGTTGG - Intergenic
952734133 3:36671523-36671545 CAACTTTGTTGAAGATCAGTAGG - Intergenic
953740188 3:45531682-45531704 CATCTTTTTAAAAGGACAGTAGG - Intronic
955091490 3:55755735-55755757 CAACATTTTTAGAGGTCACTAGG - Intronic
955671164 3:61404684-61404706 TTACTTTTCTTAAGGTCACTGGG - Intergenic
956126067 3:66011959-66011981 TAACTTTTTTAAAGGGCAATAGG + Intronic
957022869 3:75143748-75143770 CACCTGTTCTAACGGGCAGTAGG - Intergenic
957670511 3:83294940-83294962 CAACTTTGCCAAAGATCAGTTGG + Intergenic
957973665 3:87415898-87415920 CAACTTTGTCAAAGTTCAGTTGG - Intergenic
958901725 3:99895030-99895052 CTACTTTTCTTCAGGTTAGTTGG - Intronic
959846874 3:111043095-111043117 CAACTTTGTCAAAGATCAGTTGG - Intergenic
960396905 3:117148592-117148614 CAATATTTTTAAAGGTCAGAAGG + Intergenic
960556171 3:119033433-119033455 TAACTTTTCTAGAGTTCAGTAGG - Intronic
960895001 3:122494415-122494437 CAACTTTGTCAAAGATCAGTTGG + Intronic
962269765 3:133968874-133968896 TAGATTTTCTAAATGTCAGTGGG - Intronic
962781163 3:138718827-138718849 CAACTTTGCTGAAGATCAGATGG + Intronic
963443004 3:145364942-145364964 CAACTTTGTCAAAGGTCAATTGG + Intergenic
963577068 3:147074404-147074426 CAACTTTGCCAAAGATCAGTTGG - Intergenic
963763930 3:149313792-149313814 CAACTTTGTCAAAGATCAGTTGG - Intergenic
964627809 3:158776255-158776277 CACCTTTTCTACAGGGCAGATGG - Intronic
965147288 3:164922892-164922914 CAACTTTGTTGAAGGTCAGATGG + Intergenic
965260386 3:166475878-166475900 CAACTTTGATGAAAGTCAGTGGG + Intergenic
965880173 3:173379792-173379814 CAATTTTGCCAAAGGTCAGTTGG + Intergenic
965968039 3:174520418-174520440 CAACTTTATCAAAGATCAGTTGG - Intronic
966517687 3:180837021-180837043 CAACTTTGTCAAAGATCAGTTGG - Intronic
966964560 3:184977748-184977770 CAACTTTTTCAAAGCTCAGATGG + Intronic
968046115 3:195624703-195624725 CAGGTCTTCTACAGGTCAGTGGG - Intergenic
968308539 3:197665384-197665406 CAGGTCTTCTACAGGTCAGTGGG + Intergenic
969863859 4:10059464-10059486 CAATTTTTTAAAAGGTCAGTGGG + Intergenic
970144391 4:13019421-13019443 CAACTTTTCTTAAGTTAATTAGG - Intergenic
970169068 4:13271117-13271139 CAACTTTGCCAAAGATCAGTTGG + Intergenic
971260075 4:25048465-25048487 CAACTTTTTCAAAGATCAGATGG + Intergenic
971564685 4:28122460-28122482 CAACTTTTTCAAAGATCAGTTGG + Intergenic
971597178 4:28545431-28545453 CAATATTTCTAAAGGTGAGAAGG - Intergenic
972256594 4:37362527-37362549 CAACTTTGTCAAAGGTCAGATGG - Intronic
973247769 4:48028283-48028305 CAACTTTGTCAAAGATCAGTTGG - Intronic
974309876 4:60191476-60191498 CATCTTTTTCAAAGGTCAGATGG - Intergenic
974544274 4:63280005-63280027 CAACTTTTTCAAAGATCAGTAGG - Intergenic
974583669 4:63840269-63840291 CAACTTTGTCAAAGATCAGTTGG + Intergenic
974974203 4:68869778-68869800 TAACTTTTCTTTAAGTCAGTTGG - Intergenic
979976238 4:127199586-127199608 CAACTTTGCCAAAGATCAGCTGG - Intergenic
980017616 4:127670820-127670842 CAACTTTGTCAAAGGTCAATTGG - Intronic
980500716 4:133649385-133649407 CAACTTTGTTGAAGGTCAGATGG + Intergenic
980948864 4:139351405-139351427 CAACTCTGCTAAATGTAAGTTGG + Intronic
981593179 4:146388280-146388302 CAACTTTGTCAAAGGTCAGTTGG - Intronic
982534563 4:156593644-156593666 CATATTTTCTAAAGGTCTATTGG + Intergenic
983270572 4:165557017-165557039 CAACTTTTCTACATACCAGTGGG - Intergenic
983404627 4:167312502-167312524 CAACTTTTTCAAAGGTCAATTGG - Intergenic
983831532 4:172333970-172333992 CAACTTTGTTGAAGGTCAGTTGG + Intronic
984247764 4:177296086-177296108 GACCCTTTCCAAAGGTCAGTGGG + Intergenic
985747194 5:1654172-1654194 CAGGTCTTCTACAGGTCAGTGGG + Intergenic
986659700 5:10047977-10047999 CTACTTTTCTTTAGGCCAGTTGG + Intergenic
986909647 5:12538996-12539018 CAACTTTGTTGAAGATCAGTAGG - Intergenic
987806283 5:22773361-22773383 CAACTTTTTTGAAGATCAGATGG - Intronic
988397731 5:30716172-30716194 CAAGTGTTCAAAATGTCAGTTGG - Intergenic
988431962 5:31129465-31129487 CAACTTTTCTAAAGCTCCTTTGG + Intergenic
988478271 5:31607378-31607400 CAACATTTCTAAAGTTCACAAGG + Intergenic
988645308 5:33088852-33088874 CAACTTTGTCAAAGATCAGTTGG + Intergenic
989041733 5:37236284-37236306 CGACTTTGCTGAAGATCAGTTGG - Intronic
991293270 5:65054279-65054301 CAGCTTTTTTGAAGATCAGTTGG + Intergenic
991468640 5:66943176-66943198 TAACTTTTCTAATGTTAAGTGGG - Intronic
991703806 5:69339048-69339070 AAACTTTTCTAAATGTCATGTGG - Intergenic
992286814 5:75244070-75244092 CAACTTTTCAAAATTACAGTTGG - Intergenic
992606413 5:78461458-78461480 CAGCTTTGTTAAAGATCAGTTGG + Intronic
993184195 5:84595370-84595392 CAACATTTATAAAGTTCTGTTGG - Intergenic
993349955 5:86837620-86837642 TCACTATTCTAAAGGTCAGAAGG - Intergenic
993593211 5:89821831-89821853 CAACTATTCTAAAATTCAGATGG - Intergenic
995051560 5:107711781-107711803 CAACATTTCTAAAGGCAATTTGG - Intergenic
995155801 5:108911747-108911769 GAACTTTGTCAAAGGTCAGTTGG + Intronic
995163046 5:109004126-109004148 CAACTTTTCTGAATGACAGTTGG + Intronic
996123332 5:119695685-119695707 CAGCTTTTTCAAAGATCAGTTGG + Intergenic
996324189 5:122253357-122253379 CAACTTTGTCAAAGATCAGTTGG + Intergenic
996828709 5:127715406-127715428 CAACTTTGTTGAAGCTCAGTTGG + Intergenic
997025943 5:130061269-130061291 CAACTTTGTCAAAGGTCAATTGG - Intronic
998277772 5:140774699-140774721 CAAGTTTGTTAAAGGTCAGATGG + Intergenic
1000206495 5:159065270-159065292 TAACTTTTCTAATGGTCAAAAGG - Intronic
1002837237 6:875147-875169 CACCTTTTCTAGAGTGCAGTGGG - Intergenic
1004092887 6:12523125-12523147 CAACTTTGCCAAAGATCAGATGG + Intergenic
1004599805 6:17137745-17137767 CAACTTTGTCAAAGGTCAGATGG - Intergenic
1005623468 6:27641691-27641713 CAACTTTGTTAAAGATCAGTTGG - Intergenic
1006063588 6:31443846-31443868 CACCTTTGTTAAAAGTCAGTTGG + Intergenic
1007022691 6:38538033-38538055 CTACTTTTATAAAAGTCATTGGG + Intronic
1007315009 6:40980079-40980101 CAACTTTGTCAAAGATCAGTTGG + Intergenic
1008010721 6:46465060-46465082 CAAATTTACCAAAGGTCAGATGG + Intronic
1008352106 6:50504254-50504276 CAACTTTGTTGAAGATCAGTTGG - Intergenic
1008692025 6:53990018-53990040 CATCTTTTCTAAAAGATAGTAGG + Intronic
1008876215 6:56331561-56331583 CAACTTTGCCAAAGATCAGTTGG + Intronic
1009497254 6:64366474-64366496 CAAATTTTTTAAATGTTAGTGGG - Intronic
1009509026 6:64524752-64524774 CAACTTTGCCAAAGATCAGATGG + Intronic
1009656589 6:66554253-66554275 CAACTTTCTCAAAGGTGAGTTGG + Intergenic
1009756051 6:67941619-67941641 CAAGTTTTTTAAAGATCAGATGG - Intergenic
1010239987 6:73606341-73606363 CAACTATTCCAAATGTAAGTAGG - Intronic
1010546581 6:77165257-77165279 CAACTTTGTCAAAGATCAGTTGG + Intergenic
1011115737 6:83889545-83889567 AAACTTTTTTAAAGAGCAGTAGG - Intronic
1011173234 6:84530083-84530105 AAACTCTACTAAAGCTCAGTAGG + Intergenic
1011407103 6:87027412-87027434 CAACTTGCTCAAAGGTCAGTTGG - Intergenic
1011574661 6:88782772-88782794 CAGCTTTTCAATAGGTCTGTTGG - Intronic
1012133637 6:95527549-95527571 CAATTTTCCTACAGGTAAGTTGG - Intergenic
1012360882 6:98378102-98378124 CAGCTTTGCCAAAGGTCAGATGG + Intergenic
1013728022 6:113124854-113124876 CAACTTTCCACAAGGTCATTTGG - Intergenic
1014170638 6:118275308-118275330 AAACTTTACTAAATCTCAGTTGG + Intronic
1014330614 6:120059354-120059376 CAGCTTTGTCAAAGGTCAGTAGG - Intergenic
1014778635 6:125538318-125538340 CAACTTTTCTGGAGGTCATGTGG + Intergenic
1014806072 6:125831186-125831208 CTACTTTTCTTAAGGTAAGATGG - Intronic
1015476397 6:133663362-133663384 CAACTTTGCCAAAGATCAGAAGG - Intergenic
1015818128 6:137231086-137231108 CAACGTTTCAAAAGTTTAGTTGG - Intergenic
1016215426 6:141595033-141595055 CACCTTTGCCAAAAGTCAGTTGG + Intergenic
1018049195 6:159993503-159993525 CAACTTTGTCAAAGATCAGTTGG + Intronic
1020386299 7:7606757-7606779 CAACTTTTCAAAATGGCATTTGG - Intronic
1020499565 7:8899537-8899559 CAACTTTTTAAAAGGTCAGTTGG + Intergenic
1020810976 7:12849559-12849581 CAACTTTGCAAAAAATCAGTGGG - Intergenic
1020940025 7:14521266-14521288 CAATTTTTGTAAAGGTCAAATGG - Intronic
1021259340 7:18434122-18434144 CAACTTTGCCAAAGATCAGTTGG - Intronic
1022616351 7:31934746-31934768 AAATTTTACTCAAGGTCAGTTGG + Intronic
1023589647 7:41767626-41767648 CAAGTTTTCTATAGGCCATTTGG + Intergenic
1024681256 7:51691315-51691337 CAACTTTGTGAAAGGTCAGTTGG + Intergenic
1027518914 7:79179632-79179654 CAGCTTTACCAAAGATCAGTTGG - Intronic
1027538370 7:79435976-79435998 CAACCTTGTTAAAGATCAGTTGG - Intronic
1027912906 7:84275714-84275736 CAACATTTCAAATGTTCAGTAGG - Intronic
1027972703 7:85106084-85106106 TAACTTTTTTACAGGTCAATAGG - Intronic
1028453282 7:91010073-91010095 CAACTTTATTGAAAGTCAGTTGG + Intronic
1028668632 7:93375498-93375520 CAACATTTCTGAAGATGAGTAGG + Intergenic
1029953665 7:104614165-104614187 AAACTTATCTAAAGTTTAGTTGG + Intronic
1030929156 7:115500843-115500865 CAACTTTTTTGAATATCAGTTGG - Intergenic
1031669135 7:124520949-124520971 CAACTTTTCCAAAGATCAGATGG + Intergenic
1033420222 7:141198895-141198917 GAACTTTCCCAAAGGTCATTAGG + Intronic
1035645795 8:1218372-1218394 CAACTTTGTCAAAGATCAGTTGG + Intergenic
1036938360 8:13026868-13026890 AAACTTTTCCAAAGCTCATTTGG - Exonic
1038497102 8:28011175-28011197 CCACTTCTCTGAAGGTCTGTGGG + Intergenic
1038708330 8:29917924-29917946 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1040617361 8:49050494-49050516 CAACTGTGTTAAAGATCAGTTGG + Intergenic
1040672624 8:49710999-49711021 CAGGTTTTCCAAAGATCAGTTGG - Intergenic
1041276470 8:56164687-56164709 ATATTTTTCTAAGGGTCAGTTGG - Exonic
1041584836 8:59504023-59504045 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1041728485 8:61041116-61041138 CAACTTTGTTAAAGATCATTTGG + Intergenic
1042587064 8:70352022-70352044 CAATTTTTCAAAAGGTCACAAGG + Intronic
1042952512 8:74216085-74216107 CAACTTTGTCAAAGGTCAGTTGG + Intergenic
1043135721 8:76521665-76521687 CAACTTTGTTGAAGATCAGTTGG + Intergenic
1043230743 8:77797426-77797448 CAACTTTGTCAAAGATCAGTTGG + Intergenic
1043546910 8:81325797-81325819 CAACTTTGTCAAAGATCAGTTGG + Intergenic
1043601873 8:81949897-81949919 CAATTTTTCTTATGGTCAGGAGG + Intergenic
1044463002 8:92468844-92468866 CAACTTTTCTAAAGGTAGTTTGG + Intergenic
1044520287 8:93191391-93191413 CAACAATTTTAAAGGTTAGTAGG + Intergenic
1047139313 8:122119068-122119090 CAACTTTGTTGAAGATCAGTTGG - Intergenic
1047147329 8:122217933-122217955 AAACTATTCTAAAGTTCATTTGG + Intergenic
1047214392 8:122864771-122864793 CAATTTTTCTCACGCTCAGTGGG - Intronic
1047919918 8:129624484-129624506 CAATTTTGCTGAAGGTCAGATGG + Intergenic
1048246697 8:132811032-132811054 CAATTTTTCTCAAGGTTTGTTGG + Exonic
1048714217 8:137249704-137249726 CAGCTTTGCCAAAGGTCAGTTGG - Intergenic
1048727657 8:137405165-137405187 CAACTTTGCTAAAGTTCAGATGG - Intergenic
1051257004 9:15224170-15224192 CAGCATGGCTAAAGGTCAGTGGG - Intronic
1052394327 9:27920490-27920512 CAACTTTGTCAAAGATCAGTAGG - Intergenic
1056432890 9:86546278-86546300 CAATTGTTCTAAAGGAGAGTTGG - Intergenic
1057159695 9:92880453-92880475 CATCTTTTTCAAAAGTCAGTTGG - Intergenic
1057318018 9:93983440-93983462 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1057359775 9:94362539-94362561 AAACTTTTCTAAATGTCATGTGG - Intergenic
1057456440 9:95216978-95217000 AATATTTTCTAAATGTCAGTTGG - Intronic
1057574310 9:96229508-96229530 CAACTTTTCTAGAAATCACTTGG + Intergenic
1057663567 9:97025550-97025572 AAACTTTTCTAAATGTCATGTGG + Intergenic
1058526340 9:105862888-105862910 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1060332947 9:122692469-122692491 CAACTTTGCCAAAGATCAGTTGG - Intergenic
1061965203 9:134009889-134009911 AAAATTTTCTAAACTTCAGTTGG - Intergenic
1186699029 X:12069604-12069626 GAAATTTTAGAAAGGTCAGTGGG + Intergenic
1186862512 X:13687469-13687491 TAACTTTCTTAAATGTCAGTTGG + Intergenic
1187804065 X:23098909-23098931 CAACTTTTTTGAAGATCAGATGG - Intergenic
1188014377 X:25091904-25091926 CAGCTTTGCTAAAGATCAGATGG + Intergenic
1189861573 X:45277288-45277310 CAACTTTTTCAAAGATTAGTTGG + Intergenic
1189944012 X:46158429-46158451 TAACTTGGCTAGAGGTCAGTGGG + Intergenic
1191014962 X:55799359-55799381 CAACTTTGTGAAAGGTCAGTTGG - Intergenic
1191103086 X:56754052-56754074 AAACTTGTTTAAATGTCAGTAGG + Intergenic
1191947292 X:66549190-66549212 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1192278443 X:69657758-69657780 CAACTTTGTCAAAGATCAGTTGG + Intronic
1192600512 X:72458816-72458838 TAACTTTTAAAAAGCTCAGTTGG - Intronic
1192626712 X:72736295-72736317 CAACTTTGTCAAAGATCAGTTGG + Intergenic
1192655564 X:72989826-72989848 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1193141085 X:78027796-78027818 CAACTTTGTTGAAGATCAGTTGG - Intronic
1193224813 X:78970014-78970036 CAACTTTGTCAAAGATCAGTTGG + Intergenic
1193440100 X:81530047-81530069 CAACTTTGTTAAAGATCAGATGG + Intergenic
1193502110 X:82290322-82290344 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1193528058 X:82618084-82618106 CAGCTTTGCTAAAGATCAGATGG + Intergenic
1193557844 X:82978324-82978346 CAGCTTTTTTGAAGATCAGTTGG - Intergenic
1193592002 X:83400587-83400609 CAACTTTGTTGAAGATCAGTTGG - Intergenic
1193636311 X:83953746-83953768 CTACTTTGCCAAAGATCAGTTGG - Intergenic
1193858680 X:86638119-86638141 CAACTTTGTTAAACATCAGTTGG - Intronic
1193901880 X:87189675-87189697 CAACTTTTTTAGAAATCAGTAGG - Intergenic
1194529713 X:95030675-95030697 CAACTTTGCCAAAGATGAGTTGG + Intergenic
1194649948 X:96502600-96502622 CAACTTTGTTAAAGATCAGATGG + Intergenic
1195222061 X:102754406-102754428 CAACTTTTCTAGTTGTCAGTTGG - Intergenic
1197086570 X:122483411-122483433 CAACTTTGTCAAAGATCAGTTGG - Intergenic
1197704677 X:129625588-129625610 CCACTTTGCTGAAGATCAGTTGG - Intergenic
1197898627 X:131344051-131344073 AAAGTTTTCTAAAGGTGATTTGG - Intronic
1198132120 X:133706079-133706101 CAACTTTGCCAAAGATCAGATGG - Intronic