ID: 1097432883

View in Genome Browser
Species Human (GRCh38)
Location 12:59530353-59530375
Sequence GCGGACACACACTGCGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097432883_1097432891 10 Left 1097432883 12:59530353-59530375 CCCAAATCGCAGTGTGTGTCCGC No data
Right 1097432891 12:59530386-59530408 TATTGCTCATAATGTCCGGTGGG No data
1097432883_1097432893 12 Left 1097432883 12:59530353-59530375 CCCAAATCGCAGTGTGTGTCCGC No data
Right 1097432893 12:59530388-59530410 TTGCTCATAATGTCCGGTGGGGG No data
1097432883_1097432889 6 Left 1097432883 12:59530353-59530375 CCCAAATCGCAGTGTGTGTCCGC No data
Right 1097432889 12:59530382-59530404 GTGATATTGCTCATAATGTCCGG No data
1097432883_1097432890 9 Left 1097432883 12:59530353-59530375 CCCAAATCGCAGTGTGTGTCCGC No data
Right 1097432890 12:59530385-59530407 ATATTGCTCATAATGTCCGGTGG No data
1097432883_1097432892 11 Left 1097432883 12:59530353-59530375 CCCAAATCGCAGTGTGTGTCCGC No data
Right 1097432892 12:59530387-59530409 ATTGCTCATAATGTCCGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097432883 Original CRISPR GCGGACACACACTGCGATTT GGG (reversed) Intergenic
No off target data available for this crispr