ID: 1097432892

View in Genome Browser
Species Human (GRCh38)
Location 12:59530387-59530409
Sequence ATTGCTCATAATGTCCGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097432883_1097432892 11 Left 1097432883 12:59530353-59530375 CCCAAATCGCAGTGTGTGTCCGC No data
Right 1097432892 12:59530387-59530409 ATTGCTCATAATGTCCGGTGGGG No data
1097432881_1097432892 15 Left 1097432881 12:59530349-59530371 CCTCCCCAAATCGCAGTGTGTGT No data
Right 1097432892 12:59530387-59530409 ATTGCTCATAATGTCCGGTGGGG No data
1097432882_1097432892 12 Left 1097432882 12:59530352-59530374 CCCCAAATCGCAGTGTGTGTCCG No data
Right 1097432892 12:59530387-59530409 ATTGCTCATAATGTCCGGTGGGG No data
1097432885_1097432892 -8 Left 1097432885 12:59530372-59530394 CCGCCTCCCTGTGATATTGCTCA No data
Right 1097432892 12:59530387-59530409 ATTGCTCATAATGTCCGGTGGGG No data
1097432884_1097432892 10 Left 1097432884 12:59530354-59530376 CCAAATCGCAGTGTGTGTCCGCC No data
Right 1097432892 12:59530387-59530409 ATTGCTCATAATGTCCGGTGGGG No data
1097432880_1097432892 16 Left 1097432880 12:59530348-59530370 CCCTCCCCAAATCGCAGTGTGTG No data
Right 1097432892 12:59530387-59530409 ATTGCTCATAATGTCCGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097432892 Original CRISPR ATTGCTCATAATGTCCGGTG GGG Intergenic
No off target data available for this crispr