ID: 1097432893

View in Genome Browser
Species Human (GRCh38)
Location 12:59530388-59530410
Sequence TTGCTCATAATGTCCGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097432885_1097432893 -7 Left 1097432885 12:59530372-59530394 CCGCCTCCCTGTGATATTGCTCA No data
Right 1097432893 12:59530388-59530410 TTGCTCATAATGTCCGGTGGGGG No data
1097432881_1097432893 16 Left 1097432881 12:59530349-59530371 CCTCCCCAAATCGCAGTGTGTGT No data
Right 1097432893 12:59530388-59530410 TTGCTCATAATGTCCGGTGGGGG No data
1097432884_1097432893 11 Left 1097432884 12:59530354-59530376 CCAAATCGCAGTGTGTGTCCGCC No data
Right 1097432893 12:59530388-59530410 TTGCTCATAATGTCCGGTGGGGG No data
1097432886_1097432893 -10 Left 1097432886 12:59530375-59530397 CCTCCCTGTGATATTGCTCATAA No data
Right 1097432893 12:59530388-59530410 TTGCTCATAATGTCCGGTGGGGG No data
1097432880_1097432893 17 Left 1097432880 12:59530348-59530370 CCCTCCCCAAATCGCAGTGTGTG No data
Right 1097432893 12:59530388-59530410 TTGCTCATAATGTCCGGTGGGGG No data
1097432883_1097432893 12 Left 1097432883 12:59530353-59530375 CCCAAATCGCAGTGTGTGTCCGC No data
Right 1097432893 12:59530388-59530410 TTGCTCATAATGTCCGGTGGGGG No data
1097432882_1097432893 13 Left 1097432882 12:59530352-59530374 CCCCAAATCGCAGTGTGTGTCCG No data
Right 1097432893 12:59530388-59530410 TTGCTCATAATGTCCGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097432893 Original CRISPR TTGCTCATAATGTCCGGTGG GGG Intergenic
No off target data available for this crispr