ID: 1097435752

View in Genome Browser
Species Human (GRCh38)
Location 12:59550606-59550628
Sequence CCTTATATCCAGGGGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097435745_1097435752 -6 Left 1097435745 12:59550589-59550611 CCCTCTGTTATATTGTTCCTTAT No data
Right 1097435752 12:59550606-59550628 CCTTATATCCAGGGGGAAAGAGG No data
1097435743_1097435752 19 Left 1097435743 12:59550564-59550586 CCCAATATCACAGGGGGTGTACA No data
Right 1097435752 12:59550606-59550628 CCTTATATCCAGGGGGAAAGAGG No data
1097435746_1097435752 -7 Left 1097435746 12:59550590-59550612 CCTCTGTTATATTGTTCCTTATA No data
Right 1097435752 12:59550606-59550628 CCTTATATCCAGGGGGAAAGAGG No data
1097435744_1097435752 18 Left 1097435744 12:59550565-59550587 CCAATATCACAGGGGGTGTACAC No data
Right 1097435752 12:59550606-59550628 CCTTATATCCAGGGGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097435752 Original CRISPR CCTTATATCCAGGGGGAAAG AGG Intergenic
No off target data available for this crispr