ID: 1097437421

View in Genome Browser
Species Human (GRCh38)
Location 12:59568346-59568368
Sequence ACTGAGAAGCAGAATGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097437418_1097437421 -5 Left 1097437418 12:59568328-59568350 CCATTATGAAAAAGAATTACTGA No data
Right 1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG No data
1097437417_1097437421 17 Left 1097437417 12:59568306-59568328 CCAAAGAAAATTAATTTGTCTTC No data
Right 1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097437421 Original CRISPR ACTGAGAAGCAGAATGAGAG GGG Intergenic
No off target data available for this crispr