ID: 1097437636

View in Genome Browser
Species Human (GRCh38)
Location 12:59570874-59570896
Sequence ATGCTGAATCAGAGCACACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097437629_1097437636 25 Left 1097437629 12:59570826-59570848 CCTGGACCCGTGAATCCTGGCTA 0: 42
1: 194
2: 242
3: 170
4: 201
Right 1097437636 12:59570874-59570896 ATGCTGAATCAGAGCACACACGG No data
1097437632_1097437636 18 Left 1097437632 12:59570833-59570855 CCGTGAATCCTGGCTATGGAAGA No data
Right 1097437636 12:59570874-59570896 ATGCTGAATCAGAGCACACACGG No data
1097437633_1097437636 10 Left 1097437633 12:59570841-59570863 CCTGGCTATGGAAGAAACAGTAC No data
Right 1097437636 12:59570874-59570896 ATGCTGAATCAGAGCACACACGG No data
1097437631_1097437636 19 Left 1097437631 12:59570832-59570854 CCCGTGAATCCTGGCTATGGAAG No data
Right 1097437636 12:59570874-59570896 ATGCTGAATCAGAGCACACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097437636 Original CRISPR ATGCTGAATCAGAGCACACA CGG Intergenic
No off target data available for this crispr