ID: 1097437885

View in Genome Browser
Species Human (GRCh38)
Location 12:59572535-59572557
Sequence AAATTGCCACAGATGAGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097437885_1097437888 2 Left 1097437885 12:59572535-59572557 CCTAGACTCATCTGTGGCAATTT No data
Right 1097437888 12:59572560-59572582 CGAGTGCCAGAATGCATGATTGG No data
1097437885_1097437890 24 Left 1097437885 12:59572535-59572557 CCTAGACTCATCTGTGGCAATTT No data
Right 1097437890 12:59572582-59572604 GCATAGACATACCTAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097437885 Original CRISPR AAATTGCCACAGATGAGTCT AGG (reversed) Intergenic
No off target data available for this crispr