ID: 1097438280

View in Genome Browser
Species Human (GRCh38)
Location 12:59577427-59577449
Sequence CACCAAAGTATGCCCTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097438280_1097438284 9 Left 1097438280 12:59577427-59577449 CCTGCCAAGGGCATACTTTGGTG No data
Right 1097438284 12:59577459-59577481 CTGAGGCCCAGCACTAGGTATGG No data
1097438280_1097438283 4 Left 1097438280 12:59577427-59577449 CCTGCCAAGGGCATACTTTGGTG No data
Right 1097438283 12:59577454-59577476 ATTTTCTGAGGCCCAGCACTAGG No data
1097438280_1097438287 22 Left 1097438280 12:59577427-59577449 CCTGCCAAGGGCATACTTTGGTG No data
Right 1097438287 12:59577472-59577494 CTAGGTATGGCTTATCCTCATGG No data
1097438280_1097438282 -8 Left 1097438280 12:59577427-59577449 CCTGCCAAGGGCATACTTTGGTG No data
Right 1097438282 12:59577442-59577464 CTTTGGTGTATAATTTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097438280 Original CRISPR CACCAAAGTATGCCCTTGGC AGG (reversed) Intergenic
No off target data available for this crispr