ID: 1097446486

View in Genome Browser
Species Human (GRCh38)
Location 12:59678636-59678658
Sequence GCTCATGGGCAGCCACGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 10, 3: 82, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097446475_1097446486 23 Left 1097446475 12:59678590-59678612 CCAGGGTTTTTATGGGCTTCAGA 0: 22
1: 50
2: 102
3: 192
4: 380
Right 1097446486 12:59678636-59678658 GCTCATGGGCAGCCACGGGTAGG 0: 1
1: 0
2: 10
3: 82
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097446486 Original CRISPR GCTCATGGGCAGCCACGGGT AGG Intronic
900234002 1:1577932-1577954 GCCCATGGGCAGCCATGGACGGG - Intergenic
900323625 1:2096777-2096799 GGTCAGGGGCAGCCAAGGGAAGG + Intronic
900582574 1:3416368-3416390 GCTAGTGGGCAGCCAGGGCTAGG + Intronic
904365733 1:30010008-30010030 GTCCATGGGCAGCCATGGGTGGG + Intergenic
904443795 1:30551177-30551199 GTCCATGGGCAGCCATGGGCAGG - Intergenic
904577420 1:31514077-31514099 GTCCACGGGCAGCCATGGGTGGG + Intergenic
905215165 1:36401576-36401598 GCCCATGGGTGGCCATGGGTGGG + Intergenic
905664291 1:39753205-39753227 GCAAATGGGCAGGCAGGGGTTGG + Intronic
906448257 1:45922200-45922222 GTCCATGGGCGGCCATGGGTGGG + Intronic
906854774 1:49292459-49292481 GCCCATGGGTGGCCATGGGTGGG - Intronic
907957623 1:59245776-59245798 TGTCATGGGCAGCAAGGGGTGGG - Intergenic
909238291 1:73180733-73180755 GTGCATGGGCAGCCATGGGAGGG + Intergenic
909282314 1:73770878-73770900 GTTCATGGGCAGCCATGGGTGGG - Intergenic
909599642 1:77448266-77448288 GCCCATGGGAAGCCATGGATGGG - Intronic
912881826 1:113423621-113423643 GTCCATGCGCAGCCATGGGTAGG + Intronic
914846063 1:151283971-151283993 ACTCATGGGGAGACACTGGTAGG + Intronic
915185097 1:154098693-154098715 GTCCATGGGCAGCCATGGGTGGG + Intronic
917848806 1:179042900-179042922 GCCCATGGGTGGCCATGGGTGGG + Intronic
917869734 1:179230068-179230090 GCTCAGGTGCAGGCACAGGTGGG + Intergenic
918820636 1:189250090-189250112 GGTCCGGGGCAGCCATGGGTAGG - Intergenic
919205732 1:194420295-194420317 GTCCATGGGCAGCCATGGGCAGG + Intergenic
920043049 1:203116334-203116356 GCTCAGGGGCAGCGACAGCTGGG + Intronic
922336628 1:224623582-224623604 GCTCAGAGGCAGTCAGGGGTGGG - Intronic
922592171 1:226785457-226785479 GCTCCTGGGCAGTCAGGGCTTGG + Intergenic
922822478 1:228493891-228493913 GCTCTGGGACTGCCACGGGTTGG - Exonic
923391370 1:233516228-233516250 GTCCATGGGCAGCCATGGGTGGG - Intergenic
923476945 1:234342993-234343015 GCCCATGGGCAGTCCCAGGTGGG - Intergenic
1064010323 10:11730267-11730289 GTGCATGGGCAGCCATGGGTGGG - Intergenic
1067258690 10:44667156-44667178 GTCCATGGGCAGCCATGGGTGGG + Intergenic
1067456048 10:46420025-46420047 GCTCATTAGCAGCCAAGGGAGGG + Intergenic
1067631151 10:47964614-47964636 GCTCATTAGCAGCCAAGGGAGGG - Intergenic
1068137510 10:52965364-52965386 GTCCATGGGTAGCCATGGGTGGG + Intergenic
1068157698 10:53222836-53222858 GTTCATGGACAGCCATGGGCAGG + Intergenic
1068226963 10:54117908-54117930 GTCCATGGGCAGCCAGGGGCAGG + Intronic
1068287662 10:54961534-54961556 GTCCATGGGCAGCCATGGGTGGG - Intronic
1068919261 10:62465539-62465561 GTCCATGGGAAGCCATGGGTGGG - Intronic
1069212525 10:65779543-65779565 GTCCATGGGCAGCCACGGATGGG - Intergenic
1069249114 10:66245958-66245980 GCTCATGGGCAACCATTGGTGGG + Intronic
1069501452 10:68956544-68956566 GCTTATAGGCATCCACAGGTCGG + Intronic
1070576453 10:77682489-77682511 GCTCAGGGGCTGCCAGGGGTGGG + Intergenic
1071166784 10:82816529-82816551 GTCCATGGGCAGCCATGGGTGGG + Intronic
1071819392 10:89264718-89264740 GTCCATGGGCGGCCATGGGTGGG + Intronic
1071844949 10:89512388-89512410 GCTCCTGGGCAGCCTCAGGTTGG + Intronic
1073289979 10:102408761-102408783 GGTCATGGGCAGCCAGAGGCGGG - Intronic
1073833374 10:107412504-107412526 GTGCATGGCCTGCCACGGGTTGG + Intergenic
1075007805 10:118842903-118842925 GCCCATGGGCAGCCATAGGTGGG - Intergenic
1076894649 10:133303982-133304004 GCTAATGAGCAGCCACTGGTGGG - Intronic
1077012811 11:386323-386345 GTGCATGGGCAGCCATGGGTGGG - Intergenic
1077305376 11:1866588-1866610 GCTTATGGGGGGCCAGGGGTAGG - Exonic
1079144607 11:17839587-17839609 GCTCACTGGCAGCCTGGGGTAGG - Intronic
1079472307 11:20790049-20790071 GCCCATGGGCAGCCATGGATAGG + Intronic
1079882323 11:25943802-25943824 GTCCATGGGCAGCCATGGGCAGG + Intergenic
1080208332 11:29756368-29756390 GTCCATGGGCTGCCATGGGTGGG + Intergenic
1081082244 11:38756569-38756591 GTCCATGGGTAGCCAAGGGTGGG + Intergenic
1082750103 11:57006017-57006039 GTCCATGAGCAGCCATGGGTAGG + Intergenic
1084421228 11:69061656-69061678 GCTCATGGGGACCCCCAGGTGGG + Intronic
1084553313 11:69862024-69862046 GCTCAGGGGCAGGCAGTGGTGGG - Intergenic
1085032253 11:73279890-73279912 TCTGATGGGCAGCCAGGGTTGGG + Intronic
1086108162 11:83169288-83169310 CCACATGGTCAGCCAGGGGTTGG + Exonic
1086268247 11:85028290-85028312 GTCCATGGGCAGCCAAGAGTAGG + Intronic
1086268270 11:85028427-85028449 GCTCCTGGGCAGAAAGGGGTAGG - Intronic
1087453424 11:98353367-98353389 GTCCATGGGCAGCCATGGGCGGG + Intergenic
1088287985 11:108207252-108207274 GTCCATGGACAGCCATGGGTGGG + Intronic
1088328836 11:108629212-108629234 GCTCCTGGGCAGAAAGGGGTGGG - Intergenic
1088651134 11:111958758-111958780 GTTCATGGGTGGCCATGGGTAGG - Intronic
1090754634 11:129779113-129779135 GTTCATGGGCTGCTACTGGTGGG + Intergenic
1092502984 12:9065757-9065779 GTCCATGGGCAGCCATGAGTGGG - Intergenic
1095603196 12:44037634-44037656 GTTCATGGGTGGCCATGGGTGGG - Intronic
1095727503 12:45469498-45469520 GTCCATGGGCAGCCATGGGCGGG - Intergenic
1096532249 12:52249368-52249390 GCTCATGGTCAGCCAGGCCTGGG + Intronic
1097076257 12:56397135-56397157 GCCCACGGGAAGCCATGGGTGGG + Intergenic
1097130878 12:56810046-56810068 GTCCATGGGCAGCCACGGGCAGG + Intergenic
1097446486 12:59678636-59678658 GCTCATGGGCAGCCACGGGTAGG + Intronic
1097491983 12:60282417-60282439 GTTCATGGGCAACCATGGGCAGG + Intergenic
1097572921 12:61356152-61356174 GCTCCTGGGCAGACGGGGGTAGG - Intergenic
1098465634 12:70783592-70783614 GTTCATGGGCAGCCATGGGTGGG + Intronic
1098790580 12:74816998-74817020 GTCCATGGGCAGCCATGGGGAGG - Intergenic
1099683413 12:85856905-85856927 GTTCATGGGCAGCCATGGGTGGG + Intergenic
1103561782 12:121796642-121796664 GCTCATGGGCAGCCAAGGCCTGG - Intronic
1106325442 13:28684590-28684612 GTCCATGGGCAGCCATGGGCCGG - Intergenic
1106576307 13:30978978-30979000 GTCCATGGGCGGCCATGGGTGGG + Intergenic
1106979139 13:35256523-35256545 GCTCCTGGGCAGAAAGGGGTGGG - Intronic
1107171041 13:37342092-37342114 GTCCATGGGCAGCCATGGGCAGG + Intergenic
1107513576 13:41107858-41107880 GTCCATGGGCAGCCATGGGCGGG - Intergenic
1108559413 13:51627971-51627993 GTTCGTGGGCAGCCATGGGCAGG + Intronic
1109438907 13:62343597-62343619 GTTCATGGGTGGCCATGGGTGGG - Intergenic
1109470652 13:62799563-62799585 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1109762203 13:66845034-66845056 GTCCATAGGCAGCCATGGGTGGG + Intronic
1110439119 13:75507875-75507897 GCTCATGGGCGGCCACGGGCAGG + Intergenic
1110670262 13:78169289-78169311 GCCCATGGGTGGCCATGGGTGGG + Intergenic
1110778004 13:79432565-79432587 GTCCATAGGCAGCCATGGGTGGG - Intergenic
1111595372 13:90404079-90404101 GTTCATGGGCAGCCATGGGAAGG - Intergenic
1113229323 13:108195134-108195156 ATCCATGGGCAACCACGGGTGGG - Intergenic
1113339154 13:109404820-109404842 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1113571916 13:111363816-111363838 GCTGATGGGCAGCTATGGGAAGG + Intergenic
1114429612 14:22649196-22649218 TCTCATGGGCATCCAAGAGTAGG - Intergenic
1116313744 14:43360160-43360182 GTCCATGGGCAGCCATGGATGGG + Intergenic
1120745506 14:88147512-88147534 ATCCATGGGCAGCCACGGGTGGG - Intergenic
1121695344 14:95907979-95908001 GTCCATGGGCAGCCATGGGTGGG + Intergenic
1122386060 14:101349089-101349111 GTTCATGGGCAGCCATGGGTGGG + Intergenic
1202940846 14_KI270725v1_random:143790-143812 GTCCATGGGCAGCCATGGGCGGG - Intergenic
1123987659 15:25659352-25659374 GCTCCTGGGGCGCAACGGGTGGG - Intergenic
1125241573 15:37582532-37582554 GTCCATGGGCAGCCATGGGCAGG - Intergenic
1125718119 15:41831091-41831113 GTCCATGGGCAGCCATGGGTGGG - Intronic
1126292611 15:47099455-47099477 GTCCATGGGCAGCCATGGGCGGG + Intergenic
1126849220 15:52787402-52787424 TCTCATTGGCAGGCACGAGTTGG + Intronic
1128378558 15:67094366-67094388 GCTCAGGAGGAGCCACGGGGTGG - Intronic
1128847861 15:70917343-70917365 GCCCATGGGCGGCCACAGGCAGG - Intronic
1131999291 15:98163239-98163261 GCCCATGGGCAGCCACGGGCAGG + Intergenic
1132691759 16:1184721-1184743 GCACATGGGCAGGCATAGGTTGG - Intronic
1132708842 16:1257765-1257787 GCCCAGGGGGAGACACGGGTCGG + Intronic
1133287874 16:4698859-4698881 GCTCCAGGGCATCCCCGGGTGGG + Exonic
1134746896 16:16595478-16595500 GCTGATGAGCAGCCACAGGATGG + Intergenic
1134998578 16:18758185-18758207 GCTGATGAGCAGCCACAGGATGG - Intergenic
1135057070 16:19240561-19240583 GTCCATGGGCAGCCATGGGCTGG + Intronic
1136585039 16:31179440-31179462 GCCCCTGGGGAGCCACGGGGCGG - Intergenic
1137343908 16:47636934-47636956 GTCCATGGGCGGCCATGGGTGGG - Intronic
1137867280 16:51913427-51913449 GCTCATAAGCAGCAAAGGGTGGG - Intergenic
1138130431 16:54474844-54474866 GCTCATGGGCAGCCCAAGCTGGG - Intergenic
1138394803 16:56695679-56695701 GCCCATGGGTAGCCATGGGCGGG - Intronic
1140103507 16:71938589-71938611 GTCCATGGGCAGCCATGGGTGGG - Intronic
1141760916 16:86028026-86028048 GCCCAGTGGCAGCCAAGGGTTGG - Intergenic
1142095216 16:88235681-88235703 CCTCATGGGGAACCACGGTTTGG - Intergenic
1143143823 17:4760156-4760178 GGTCAGTGGCAGCCAGGGGTTGG - Intergenic
1143521500 17:7446796-7446818 GCTGAGGGGCTGCCCCGGGTTGG - Intronic
1143526872 17:7478252-7478274 GATCATGGGCAGCCAAGCGAGGG - Intronic
1144781243 17:17809664-17809686 GGGCATGGGCAGCCAGGGGCTGG + Intronic
1145217067 17:21060739-21060761 GTCCATGGGCAGCCATGGGTAGG + Intergenic
1145265453 17:21377638-21377660 GCTCATGGGCAGAGACAGCTGGG + Intronic
1145889040 17:28402158-28402180 GCTGATGGGCAGCCATGGCTGGG - Exonic
1147790758 17:43013199-43013221 GCTCATGGGGAGCCTCAGGAGGG + Intronic
1148779948 17:50115774-50115796 GCACATGGGGAGCCAGGGGCGGG + Intronic
1149576293 17:57715838-57715860 GGTGATGGGCAGCCTCGGGTGGG + Intergenic
1150315616 17:64166421-64166443 GCTCATGGGCAGCCTCTGATGGG + Intronic
1151150975 17:72086572-72086594 GCTCATGGGCAGTAATGGTTTGG + Intergenic
1151158655 17:72146060-72146082 ACTCATGTGCAGCCACAGCTAGG - Intergenic
1151395292 17:73819295-73819317 GTCCATGGGCAGCCATGGGCAGG + Intergenic
1151883115 17:76906451-76906473 GCTCAGGGGCTGACACGTGTTGG + Intronic
1151895161 17:76975085-76975107 GTGTATGGGCAGCCATGGGTGGG - Intergenic
1152365886 17:79856032-79856054 GCTCCTGGGGAGCCACCGGCTGG + Intergenic
1152530366 17:80914945-80914967 ATTCATGGGCAGCCATGGGCAGG - Intronic
1152646904 17:81473427-81473449 GGTGATGGGCACCCCCGGGTGGG - Intergenic
1152864223 17:82712707-82712729 GTTCATGGGCGGCCATGGGTGGG + Intergenic
1153723980 18:7936762-7936784 GTTCATGGGTGGCCATGGGTGGG - Intronic
1154309693 18:13257524-13257546 GCTCATGGGCAGGCGTGTGTGGG + Intronic
1155215746 18:23641670-23641692 GTCCATGGGAAGCCATGGGTGGG - Intronic
1158838867 18:61361616-61361638 GGTCATGGGCAGGCACTGGTTGG - Intronic
1159186683 18:64984073-64984095 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1159969846 18:74635776-74635798 GCCAATGAGCAGCCACAGGTAGG - Intronic
1160474181 18:79167672-79167694 GTCCATGGGCAGCCATGGGCGGG + Intronic
1161173217 19:2823848-2823870 GTTCATGGGCGGCCATGGGAGGG + Intronic
1163820267 19:19492432-19492454 CCTCATGGTGAGCCACGTGTTGG + Exonic
1164593793 19:29520567-29520589 GCTCGTGGTCAGCCAGGGGTTGG - Intergenic
1166233451 19:41439549-41439571 GCTAATGGACAGGCAAGGGTGGG - Intronic
1166701766 19:44886226-44886248 GCTCATGGGAAGACAAAGGTGGG + Intronic
1167346065 19:48946474-48946496 ACCCATGTGCAGCCAGGGGTGGG - Intergenic
1168630193 19:57950330-57950352 GCCCATGGGCAGTCATGGGCGGG + Intergenic
925069728 2:956588-956610 GCCCATTCACAGCCACGGGTGGG - Intronic
927226191 2:20767734-20767756 GTCCATGGGCAGCCAGGGGTAGG - Intronic
927266897 2:21162160-21162182 GTTCATGGGCAGCCATGGGTGGG + Intergenic
927743182 2:25590727-25590749 GTTCATGGGTGGCCATGGGTAGG + Intronic
928723616 2:34147592-34147614 GTCCATGGGCAGCCATGGGTGGG + Intergenic
929568082 2:43002248-43002270 GCTCACATGCAGCCACAGGTTGG - Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930313676 2:49772151-49772173 GTTCAGGGGCAGCCATGGGCAGG + Intergenic
930946642 2:57084227-57084249 GTCCATGGGCAGCCATGGGTGGG + Intergenic
931300493 2:60973801-60973823 GTCCATGGGCAGCCATGGGTGGG - Intronic
932398293 2:71463042-71463064 GCTCCTGGGCAGAAAGGGGTGGG - Intronic
932837539 2:75051295-75051317 GCTCATGGCCAGCCACATGATGG + Exonic
933063595 2:77768184-77768206 GTTCATGGGCAGCCATGGGTGGG - Intergenic
934859046 2:97748876-97748898 GCTCATGGCCTCCCACGGGAGGG - Intergenic
935817444 2:106859977-106859999 ACTCAGGGGCAGCAAGGGGTCGG - Intronic
937160938 2:119760190-119760212 GCTGCTGGGCAGCCGCGGGCCGG - Exonic
937267350 2:120624893-120624915 GCTCATGGGCAGCCTGGGGCAGG + Intergenic
938180651 2:129179178-129179200 GTCCATGGGCGGCCATGGGTAGG + Intergenic
939084940 2:137707980-137708002 GTCCATGGGCAGCCATGGGCAGG + Intergenic
940071929 2:149698505-149698527 GCTCAGGGTCTGCCACTGGTAGG - Intergenic
940612193 2:156006346-156006368 GTCCATGGGCAGCCATGGGTAGG + Intergenic
941404824 2:165074934-165074956 GCCCATGGGCAGTCATGGGCAGG - Intergenic
941432322 2:165427191-165427213 GCTCCTGGGCAGAAAGGGGTGGG + Intergenic
943023471 2:182601896-182601918 GTCCATGGGCAGCCATGGGTGGG + Intergenic
943064117 2:183069276-183069298 GTCCATGGGCAGCCATGGGTGGG - Intergenic
943179432 2:184524588-184524610 GTCCATGGGCGGCCATGGGTGGG + Intergenic
943180222 2:184530922-184530944 GTCCATGGGCAACCATGGGTGGG + Intergenic
943426987 2:187749895-187749917 GTCCATGGGCAGCCATGGATGGG + Intergenic
944901813 2:204223453-204223475 GTCCATGGGCAGCCAGGGGTGGG + Intergenic
944901845 2:204223580-204223602 GCTCCTGGGCAGAAAAGGGTGGG - Intergenic
945773601 2:214077575-214077597 GCACAGGGGCAGCCAAGGGGAGG - Intronic
945929395 2:215840016-215840038 GCTGATGGGCAGCCACAACTTGG - Intergenic
948461352 2:238131375-238131397 GCACCTGGGCACCCACGGCTGGG + Exonic
1169309362 20:4521879-4521901 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1170495024 20:16915619-16915641 GTACAAGGGCAGCCATGGGTGGG - Intergenic
1171536754 20:25899138-25899160 GTCCATGGGCAGCCATGGGGGGG - Intergenic
1171839698 20:30194403-30194425 GTCCATGGGCAGCCATGGGCGGG - Intergenic
1172347045 20:34209919-34209941 GTCCATGGGCAGCCATGGGTGGG - Intronic
1172676699 20:36677411-36677433 GCCCATGGGCGGCCATGGGCAGG - Intronic
1176582308 21:8543151-8543173 GTCCATGGGCAGCCATGGGCGGG + Intergenic
1176676098 21:9778838-9778860 GCTCTTTGGGAGCCACTGGTTGG + Intergenic
1177344914 21:19855568-19855590 GCTCCTGGGCAGAAAGGGGTAGG - Intergenic
1177875394 21:26625904-26625926 GTCCATGGGCAGCCATGGGCGGG + Intergenic
1178947394 21:36959609-36959631 GTCCATGGGCAGCCATGGGCGGG - Intronic
1180265143 22:10520199-10520221 GTCCATGGGCAGCCATGGGCGGG + Intergenic
1181727619 22:24822409-24822431 GATCAGGGGCTGCCAGGGGTTGG - Intronic
1184808538 22:46812463-46812485 GCTCTGGGGCTCCCACGGGTTGG + Intronic
1185372020 22:50465373-50465395 GCTCCTGGGCAGCCTGGGGTGGG - Intronic
1185381137 22:50507948-50507970 GCTTGGGGGCTGCCACGGGTTGG - Intergenic
951264702 3:20552413-20552435 GTCCATGGGCAGCCATGGGTGGG + Intergenic
951508883 3:23479886-23479908 GTCCATGGGCTGTCACGGGTGGG + Intronic
951562453 3:23982157-23982179 GTCCACGGGCAGCCATGGGTGGG + Intergenic
952269375 3:31817120-31817142 GGCCATGGGCAGCCATGGGCGGG + Intronic
952341486 3:32451272-32451294 GCGCAGGGGCAGCTAAGGGTAGG - Intronic
952793341 3:37217659-37217681 GTCCATGGGCAGCCATGGGCAGG - Intergenic
954398006 3:50303231-50303253 GCTCATGGGGAAGCAGGGGTGGG - Exonic
954650885 3:52162191-52162213 GTCCATGGGCAGCCATGGGTGGG + Intergenic
954984261 3:54775834-54775856 GCTCAGGGGCAGCCCCAGGAGGG + Intronic
956462301 3:69484857-69484879 GTCCATGGGCAGCCATGGGCAGG + Intronic
956985435 3:74693984-74694006 GCACATGGGAGGCCAAGGGTGGG - Intergenic
957313212 3:78545493-78545515 GCTCATTAGCAGCCAAAGGTTGG - Intergenic
957427027 3:80051803-80051825 GTCCGTGGGCAGCCACGGGCGGG - Intergenic
957459384 3:80497330-80497352 GTCCATGGGCAGCCATGGGAGGG + Intergenic
957678761 3:83404389-83404411 GTCCATGGGCGGCCATGGGTGGG - Intergenic
958019656 3:87980477-87980499 GTCCATGAGCAGCCATGGGTGGG + Intergenic
958195324 3:90235761-90235783 GTCCATGGGCTGCCATGGGTGGG - Intergenic
958418734 3:93907168-93907190 GTCCATGGGCTGCCATGGGTGGG - Intronic
958498396 3:94874770-94874792 GTCCATGGGCAGCCATGGGTGGG + Intergenic
958883212 3:99696612-99696634 GCATATGGCCAGCCACTGGTGGG + Intronic
959476818 3:106821849-106821871 GTTTATGGGTAGCCATGGGTGGG - Intergenic
960993416 3:123325999-123326021 GCTCATGGGCAGGCCAGGGTAGG + Intronic
961387037 3:126528608-126528630 GCCCATGGCCAGCCCCGGGTAGG - Intronic
962211998 3:133487102-133487124 GCCTATGGGCGGCCATGGGTGGG + Intergenic
962249755 3:133828758-133828780 TGTCATGGGAAGCCACAGGTCGG + Exonic
963087260 3:141449618-141449640 GCTACTGGCCAGCCACCGGTAGG - Exonic
965009833 3:163073492-163073514 GTCCATTGGCAGCCATGGGTGGG - Intergenic
965013931 3:163131710-163131732 GCTCATGGGTGGCCATGGGCGGG - Intergenic
965229227 3:166029326-166029348 TTCCATGGGCAGCCATGGGTGGG + Intergenic
965542065 3:169880349-169880371 GTCCATGGGCAGCCATGGGTGGG - Intergenic
965793081 3:172410861-172410883 GTCCATGGGCAGCCATGAGTGGG + Intergenic
965984652 3:174736654-174736676 GCTCATGGGCAGCCTTTCGTCGG + Intronic
968568300 4:1326576-1326598 GCTCATAGGCAGACACATGTGGG + Intronic
968612478 4:1563556-1563578 GGGCCTGGGCAGCAACGGGTGGG - Intergenic
968621212 4:1604241-1604263 GCCCTTGGGCAGCCCTGGGTGGG - Intergenic
968980761 4:3848293-3848315 GTCCATGGGCAGCCATGGGTGGG + Intergenic
969202721 4:5618483-5618505 GCTCAGGGGCAGCCACGGCCTGG + Exonic
969289746 4:6231003-6231025 GCCCTGGGGCAGCCACTGGTGGG - Intergenic
971092314 4:23360385-23360407 GTCCATGGGCAGCCATGGGAGGG + Intergenic
971092434 4:23360963-23360985 GTCCATGGGCAGCCATGGGTGGG - Intergenic
971714093 4:30153441-30153463 GCTCATGGGCAGCCATGGTTGGG + Intergenic
971869380 4:32216121-32216143 GTCCATGGGCAGCCATGGGTGGG + Intergenic
972788188 4:42346546-42346568 GTCCATGGGCAGCCATGTGTGGG - Intergenic
974023420 4:56711495-56711517 GCTCCTGGGCAGAAAAGGGTGGG + Intergenic
974432584 4:61817361-61817383 GTCCATGGGCAGCCATGGGAGGG - Intronic
975040852 4:69743421-69743443 GTCCATGGGCAGCCATGGGTGGG + Intronic
975254348 4:72216204-72216226 GTCCATGGGCAGCCATGGGAGGG + Intergenic
975913682 4:79297937-79297959 GTCCATGGGCAGCCATTGGTGGG - Intronic
976844558 4:89473244-89473266 GCCCATGGCCTGCCACAGGTTGG + Intergenic
977816230 4:101416796-101416818 GTCCATGGGCAGCTATGGGTGGG + Intronic
978061474 4:104345049-104345071 GTTCATGGGTGGTCACGGGTGGG - Intergenic
978149352 4:105415089-105415111 GCCCATGGGCAGCCATGGTTAGG + Intronic
978219724 4:106256121-106256143 GTCCATGGGCGGCCATGGGTGGG + Intronic
978301045 4:107270079-107270101 GTCCATGGGCAGCCATGGGTGGG + Intronic
978466747 4:109016529-109016551 ATCCATGGGCAGCCATGGGTTGG - Intronic
979145367 4:117239990-117240012 GCTCATGGGTGGCCCTGGGTGGG - Intergenic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
979956157 4:126955984-126956006 GTCTATGGGCAGCCATGGGTGGG - Intergenic
981727348 4:147861855-147861877 GCCCATGCGCAGCCATGAGTGGG + Intronic
982545210 4:156724696-156724718 GTTCATGGGGAGCCATGGGCAGG - Intergenic
982611063 4:157574899-157574921 GTCCATGGGCAGCCATGGGCGGG - Intergenic
982856246 4:160385777-160385799 GCTCCTGGGCAGAAATGGGTGGG - Intergenic
983069698 4:163254015-163254037 GTCCATGGGCAGCCATGGGTGGG + Intergenic
985399432 4:189579908-189579930 GCTCTTTGGGAGCCACTGGTTGG - Intergenic
985770188 5:1804979-1805001 GATCAGGGGCTGCCAGGGGTTGG - Intronic
987875420 5:23674947-23674969 GCTCATGGGCTGGTAGGGGTGGG - Intergenic
987999597 5:25331180-25331202 GTCCATGGGCAGCCATGGGCAGG - Intergenic
988202273 5:28083430-28083452 GTCCATGGGTAGCCATGGGTGGG - Intergenic
989730456 5:44641772-44641794 GTCCATGGGCAGCCATGGGTGGG + Intergenic
990639158 5:57762266-57762288 GTCCATGGGCAGCCATGGGCCGG - Intergenic
991472371 5:66983113-66983135 GCTCAGTGGCAGCAAAGGGTTGG - Intronic
991593977 5:68283762-68283784 GCTCCTGGGCAGACCCGGTTTGG - Intronic
992838919 5:80668241-80668263 GTTCATGGGCTGCCATGGGCGGG + Intronic
993384818 5:87251716-87251738 GTCCATGGGCAGCCATGGGCGGG + Intergenic
994449944 5:99929410-99929432 GTCCATGGGCAGCCATGGGCAGG + Intergenic
995724010 5:115166240-115166262 GCCCATGGGTGGCCATGGGTGGG - Intronic
995927023 5:117386507-117386529 CTCCATGGGCAGCCATGGGTGGG - Intergenic
999682342 5:154072073-154072095 TCTAATGTGCAGCCAAGGGTGGG - Intronic
999859919 5:155633863-155633885 GCTCATGGGTGGCCACGGGCAGG - Intergenic
1000232196 5:159326623-159326645 ACTCTTGGGCAGCCACTGGTGGG - Intronic
1005781949 6:29201637-29201659 GTCCTTGGGCAGCCACGGGCAGG - Intergenic
1005939545 6:30550667-30550689 TCTCATGAGAAGCCAAGGGTAGG - Intronic
1009844765 6:69121735-69121757 GATGATGGGCAGCCAGGCGTAGG + Intronic
1011284180 6:85706211-85706233 GTCCATGGGCAGCCATGGGCAGG + Intergenic
1012231163 6:96762542-96762564 ATCCATGGGCAACCACGGGTGGG + Intergenic
1013610427 6:111789320-111789342 GCTCATTGGCACACATGGGTGGG + Intronic
1015434737 6:133172656-133172678 GTCCATAGGCAGCCATGGGTGGG - Intergenic
1018655632 6:166033010-166033032 GCTCATGGCCAGCCAGTGGGCGG - Intergenic
1019430553 7:997085-997107 GGTCATGGGGAGCCCCTGGTGGG - Exonic
1019492848 7:1323183-1323205 GCCCCTGGCCAGCCCCGGGTGGG - Intergenic
1020832547 7:13110046-13110068 GTCCATAGGCAGCCATGGGTGGG + Intergenic
1021097264 7:16547990-16548012 GTTCATGGGCAGCCACGGGCAGG - Intronic
1021677681 7:23097504-23097526 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1021793970 7:24234720-24234742 TCTAATGGGCAGCCAAGGATGGG - Intergenic
1022423432 7:30245948-30245970 GTCCATGGGCAGCCATAGGTGGG + Intergenic
1022527688 7:31049138-31049160 GCTAATGTGCAGCCATGGTTAGG - Intergenic
1023289733 7:38656642-38656664 GCTCTGGGGCAGCCACAGGAGGG - Intergenic
1026393578 7:69928223-69928245 GTCCATGGGCAGCCATGGGTGGG + Intronic
1027779849 7:82507686-82507708 GTTCATGGGGTGCCATGGGTGGG + Intergenic
1031011051 7:116525730-116525752 GCTGAAGGGCAGCTACGTGTTGG - Intronic
1031786592 7:126040976-126040998 GACCATGGGCAGCCATGGGCAGG - Intergenic
1031837025 7:126690947-126690969 GTCCATGGGCAGCCATGGGTGGG + Intronic
1032315651 7:130836096-130836118 ACTCCTAGGCAGCCACTGGTGGG - Intergenic
1034090522 7:148360050-148360072 GCAGATTGGCAGCCATGGGTTGG + Intronic
1034376726 7:150651690-150651712 GGTAATTGGCAGCCACGTGTAGG - Intergenic
1036907635 8:12720455-12720477 GTCCATGGGCGGCCATGGGTGGG - Intergenic
1036915437 8:12799667-12799689 GTCTATGGGCAGCCACAGGTGGG + Intergenic
1037608516 8:20457392-20457414 GCTTTTGGGCAGCCAGGAGTTGG - Intergenic
1037777882 8:21847729-21847751 GTTCATGGGCAGCCATGGGCGGG + Intergenic
1037960937 8:23097673-23097695 GCTCCTGGACAGCCTCGGGAGGG - Intronic
1037970808 8:23170617-23170639 GCTCTTGGACAGCCTCGGGGTGG + Intergenic
1038149336 8:24928312-24928334 GTCCATGGGCAGCCACGAGTGGG - Intergenic
1039071993 8:33657292-33657314 GCTCCTAGGCAGGCAGGGGTGGG + Intergenic
1039210133 8:35204474-35204496 GTCCATGGCCAGCCATGGGTGGG + Intergenic
1041274418 8:56142556-56142578 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1042337035 8:67640098-67640120 GTCCATGGGCAGCCATGGGTGGG + Intronic
1043734227 8:83724134-83724156 GTCCATAGGCAGCCATGGGTGGG + Intergenic
1044053749 8:87542611-87542633 GTTCACGGGCAGCCACGGGCAGG + Intronic
1044962352 8:97543040-97543062 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1045358726 8:101412656-101412678 TTTGATGGGCAGCCACAGGTAGG + Intergenic
1046459728 8:114518082-114518104 GCCCATGGGCAGCCATGGATGGG + Intergenic
1046503738 8:115111414-115111436 GTCCATGGGTGGCCACGGGTAGG + Intergenic
1046775384 8:118158699-118158721 GTCCATGGGCAGCCATGGGCAGG - Intergenic
1048971094 8:139645359-139645381 GGGCATGGGCAGGCATGGGTGGG - Intronic
1049021752 8:139961773-139961795 GTCCATAGGCAGCCATGGGTGGG - Intronic
1049145691 8:141000394-141000416 CCTCGCGGGCAGCCAAGGGTGGG - Intronic
1049248915 8:141577790-141577812 GCACATGGGCAGGCAGGGGCTGG + Intergenic
1049824003 8:144655250-144655272 GCTGATGGGTGGCCATGGGTGGG - Intergenic
1050426336 9:5516399-5516421 GCCCATGGGCAGCCATGGAAGGG + Intronic
1050483981 9:6114681-6114703 GTCCATGGACAGCCATGGGTGGG - Intergenic
1051550046 9:18317602-18317624 TCTCATGTGCAGCCAAGGTTTGG + Intergenic
1052466804 9:28839681-28839703 GCCCATGGGCAGCCATGGGCAGG + Intergenic
1053128187 9:35599570-35599592 GGTCCTGGGCAGCCATGGGTGGG - Intergenic
1055457523 9:76486982-76487004 CCTCATGGCCAGCCACAGTTAGG + Intronic
1055890898 9:81122601-81122623 GTCCATGAGCAGCCATGGGTGGG + Intergenic
1056462181 9:86818641-86818663 GTCCATGGGCTGCCATGGGTGGG - Intergenic
1056986117 9:91364687-91364709 GTCCATGGGCAGCCATGGGCAGG - Intergenic
1056994429 9:91443228-91443250 GTCCATGGGCAGCCACGGGCAGG + Intergenic
1057548530 9:96035340-96035362 GTCCATGGGCAGCCAGGGGCGGG - Intergenic
1058270664 9:102968034-102968056 GCTCCTGGGCAGACAGGGGCAGG - Intergenic
1059401234 9:114071658-114071680 GCCCATGGGCGGCCATGGGTAGG - Intronic
1059565505 9:115379959-115379981 GTCCATGGGCGGCCATGGGTGGG - Intronic
1060031458 9:120218191-120218213 GGTCATGGGCAGCCCAGGGGAGG - Intergenic
1060910093 9:127342692-127342714 GCTGATGGGCAGGCAAAGGTGGG + Intronic
1061743230 9:132722463-132722485 ATCCATGGGCAGCCATGGGTGGG + Intergenic
1062109256 9:134773058-134773080 GGTCATGGGCAGCAACTGGAGGG - Intronic
1062329133 9:136029164-136029186 GTCCATGGGCAGCCATGAGTGGG - Intronic
1203612326 Un_KI270749v1:21165-21187 GTCCATGGGCAGCCATGGGCGGG + Intergenic
1185642633 X:1597054-1597076 GCTCCTGGACAGCCTCTGGTGGG + Intronic
1186805843 X:13139447-13139469 GTTCATGTGCAGCCATGGGCGGG - Intergenic
1188756520 X:33969468-33969490 GTCCATGGGCAGCCATGGGTAGG - Intergenic
1189867575 X:45347036-45347058 TCTCATGTGCAGCCAAGAGTGGG + Intergenic
1190223522 X:48528573-48528595 GCTCATGGGCAGGCACAAGAAGG + Exonic
1190360547 X:49644884-49644906 GTCCATGGGCAGCCATGGCTGGG + Intergenic
1190369515 X:49727374-49727396 GTCCATGGGCAGCCATGGGTGGG - Intergenic
1190621112 X:52287870-52287892 GTTCATGGGCAGTCATGGGCAGG - Intergenic
1191758792 X:64624604-64624626 GCTCTGGGGCAGCCACAGGAAGG - Intergenic
1192265327 X:69533744-69533766 GCCCATGGGCAGCCATGGGCAGG + Intergenic
1192557736 X:72103772-72103794 GCCCATGGGCAGCCCTGGGAGGG - Intergenic
1193417464 X:81241464-81241486 GTCCATGGGGAGCCATGGGTGGG - Intronic
1193919361 X:87406845-87406867 GTCCATGGGCAACCATGGGTTGG + Intergenic
1194205053 X:91002617-91002639 GTCCATGGGCAGCCATGGGTGGG + Intergenic
1194366522 X:93019877-93019899 GCTCATGGGCTGTCACAGGAGGG + Intergenic
1194380290 X:93181869-93181891 AGCCATGGGCAGCCATGGGTGGG - Intergenic
1194413090 X:93579085-93579107 TCCCATGGGCAGCCATGGGAGGG - Intergenic
1195179062 X:102339431-102339453 GTCCATGGGCAGCCATGGGCAGG + Intergenic
1196883655 X:120223352-120223374 TTCCATGGGCAGCCATGGGTGGG + Intergenic
1199420362 X:147637277-147637299 TCTCATGGACAGCCTCGGCTAGG + Intergenic
1200073496 X:153540236-153540258 GCTGATGAGCAGCCCAGGGTGGG + Intronic
1200103863 X:153701726-153701748 GCTCAGGCGCAGCCATGGTTTGG - Intronic
1200550879 Y:4577760-4577782 GTCCATGGGCAGCCATGGGTGGG + Intergenic
1200674750 Y:6136138-6136160 GCTCATGGGCTGTCACAGGTGGG + Intergenic