ID: 1097450250

View in Genome Browser
Species Human (GRCh38)
Location 12:59729415-59729437
Sequence CAGAATAAAGAGAGAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1575
Summary {0: 1, 1: 0, 2: 6, 3: 180, 4: 1388}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097450250 Original CRISPR CAGAATAAAGAGAGAGAGGC AGG (reversed) Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
900822036 1:4897209-4897231 CAGAAGCAGGAGGGAGAGGCGGG + Intergenic
900894591 1:5474380-5474402 CAGTAGAAGGCGAGAGAGGCAGG + Intergenic
901264406 1:7899071-7899093 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
901413680 1:9102787-9102809 CAGAATAAAAATAGAGATACAGG + Exonic
901472920 1:9470224-9470246 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
901560836 1:10068980-10069002 AAGAGTTAAGAGACAGAGGCAGG - Intronic
901653069 1:10754197-10754219 TAGAATAGGGAGTGAGAGGCAGG - Intronic
901780029 1:11587859-11587881 CAGGAGGAAGAGAGAGAGACAGG - Intergenic
902409207 1:16202827-16202849 CAAAAAAAAGAGAGAGAGAAAGG - Intronic
902441881 1:16435779-16435801 CAGTATAAATGGACAGAGGCAGG - Intronic
902745018 1:18468042-18468064 CAGAGCAAAAAGAGAGAGGTAGG + Intergenic
903286183 1:22278179-22278201 GAGATAAAAGAGAGAGAGGAAGG + Intergenic
903355261 1:22742488-22742510 CGGAAGAAAGAGAGAAAGGAAGG - Intronic
903420253 1:23213852-23213874 CAGAAAGCAGAGAGAGGGGCTGG - Intergenic
903561455 1:24231206-24231228 CAGAAAATAGGGAGAGAGCCAGG + Intergenic
903834855 1:26197204-26197226 CACAAGAAAGGGAGACAGGCGGG - Intronic
904093843 1:27962595-27962617 AAAAAAAGAGAGAGAGAGGCAGG + Intronic
904354252 1:29928377-29928399 CAGAATAAAAAGGCAGAGGAAGG - Intergenic
904868714 1:33602788-33602810 CATAAGAAAGAGAAAGAGGGAGG - Intronic
905040365 1:34951776-34951798 CAGAATAGAGAGGAAGAGACAGG - Intergenic
905042431 1:34971144-34971166 GAGAAGCAAGAGAGAGAAGCAGG - Intergenic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905577118 1:39054185-39054207 CTAAAAAGAGAGAGAGAGGCTGG + Intergenic
905638212 1:39570155-39570177 CAGCAGAAAGAGAAAAAGGCAGG + Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
905972528 1:42152968-42152990 AAGGATACAGACAGAGAGGCTGG - Intergenic
906028104 1:42692684-42692706 CGGAGTAAAGAGGGTGAGGCAGG + Intronic
906258448 1:44368123-44368145 CAGAAGAAAGAGAGGGCAGCTGG + Intergenic
906259669 1:44377539-44377561 CAGAGTACGGAGAGAGAGGGAGG + Intergenic
906818994 1:48909420-48909442 CAGATTAGAGAGAGAGATGTTGG + Intronic
906987499 1:50700310-50700332 GAGAAGAGAGAGAGAGAGGGGGG - Intronic
907097547 1:51795505-51795527 CAGAATGAAGATAGAGAGAAAGG + Intronic
907426261 1:54381086-54381108 TTTAAAAAAGAGAGAGAGGCTGG + Intronic
907773904 1:57493725-57493747 AAGAAGAAAAAGAGGGAGGCAGG + Intronic
907984666 1:59518670-59518692 CAGAAGCAAGAGAGAGAGTGGGG - Intronic
908290996 1:62667150-62667172 AAGAATGACTAGAGAGAGGCAGG - Intronic
908450009 1:64244706-64244728 GAGAATATGGAGAGAGAGGATGG - Intronic
908728923 1:67206307-67206329 CAAAAAAAAGAAAGAAAGGCTGG - Intronic
908735009 1:67267346-67267368 CAGAAGCAAGAGAGAGAGAAGGG - Intergenic
909196776 1:72636732-72636754 CAAAAGAGAGAGAGAAAGGCAGG - Intergenic
909286840 1:73830275-73830297 CAGAAAAAGGAGAGAGGGGAAGG + Intergenic
909588454 1:77318249-77318271 CAGGAGGAAGAAAGAGAGGCGGG + Intronic
910100526 1:83570664-83570686 CAAAACAAAGAGACTGAGGCAGG - Intergenic
910178288 1:84454511-84454533 CAGAAAAAAGAGAGACAGCCTGG + Intergenic
910351069 1:86298160-86298182 AAGAAGAAAGAGAGAGAGAAAGG - Intergenic
910518707 1:88093059-88093081 AAGAATAAAGAGAGAAAGGTTGG + Intergenic
910573339 1:88730387-88730409 GAGCAGAAAGAGAGAGAGCCTGG - Intronic
910584923 1:88869033-88869055 CAGAATACACAGATACAGGCCGG - Intronic
910920880 1:92345410-92345432 GAGAAGAAAGAAAGAGAGGAAGG + Intronic
911742823 1:101405914-101405936 GAGGCTCAAGAGAGAGAGGCAGG - Intergenic
911782455 1:101899376-101899398 CAGATGAAAGAGGGAGAGGAGGG + Intronic
912156260 1:106924399-106924421 CAAAACAAAGAAAGAGAAGCCGG - Intergenic
912194236 1:107378691-107378713 CAGACTACAGACAGAGAGGCTGG + Intronic
912549800 1:110477890-110477912 AAGAAGCAAGAGAGACAGGCAGG - Intergenic
912555550 1:110513641-110513663 CAGAGAAAAAGGAGAGAGGCGGG - Intergenic
912556087 1:110517160-110517182 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
912670748 1:111621362-111621384 CATAATAAAGACAGAAAGTCTGG - Intronic
912702454 1:111888387-111888409 GAGAACAAAGACAGTGAGGCCGG + Intronic
912806423 1:112760204-112760226 AAGAAGAGAGAGAGAGAGGAAGG + Intergenic
913074900 1:115333756-115333778 ATGAAGAAAGAGAGAGAGGGGGG - Intronic
913139928 1:115931040-115931062 CAGGAGGAAGAGAGAGTGGCGGG - Intergenic
913142455 1:115955016-115955038 CAAGATGAAGTGAGAGAGGCAGG + Intergenic
913216028 1:116621127-116621149 CAGGAGCAAGAGAGAGAGGGGGG - Intronic
913254431 1:116941057-116941079 AAGCACAAAGGGAGAGAGGCAGG - Intronic
913257599 1:116967992-116968014 GAGTATAAAGAAAGAGAGGAGGG + Intronic
913577664 1:120193485-120193507 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
913630506 1:120704855-120704877 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
914238326 1:145832725-145832747 TAAAATAGAGAGAGAAAGGCCGG + Intronic
914412967 1:147449329-147449351 TAAAATAAAGAGAGAGAGAAAGG - Intergenic
914439082 1:147687268-147687290 AGGAAGCAAGAGAGAGAGGCAGG - Intergenic
914559577 1:148804916-148804938 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
914613256 1:149325307-149325329 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
914715763 1:150253769-150253791 CCAAAAAAAAAGAGAGAGGCTGG + Intergenic
914929890 1:151921619-151921641 CAGAAGAAAGATAAAGAGGCAGG + Intergenic
915108181 1:153547112-153547134 CCAAAGAAAGAGAGAGAGGAAGG + Intronic
915151283 1:153833965-153833987 AAAAAAAAAGAGAGAGAGACAGG - Intronic
915188017 1:154123885-154123907 AAAAAAAGAGAGAGAGAGGCTGG + Intronic
915400307 1:155617110-155617132 CAGAATTAAGAGTGTGTGGCCGG - Intergenic
915772935 1:158448255-158448277 CAGAATCTAGAGTGAGAGACAGG - Intergenic
916287900 1:163131229-163131251 CAGGAGAAAGAGAGAGAGAAGGG - Intronic
916386405 1:164276610-164276632 AAGAAAAAAGAGAGAGAGGAAGG + Intergenic
916401494 1:164453767-164453789 AAGAAGAGAGAGAGAGAGGGAGG + Intergenic
916611427 1:166395748-166395770 GAAAAGAAAGAGAGAGAGGAAGG + Intergenic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
917180474 1:172291132-172291154 AAGAATAAAGAGGGAGAGAATGG + Intronic
917304402 1:173612258-173612280 GAAAAGAAAGAGAGAGAGGGAGG + Intronic
917389805 1:174522773-174522795 CAGGAACAAGAGAGAGAGGTGGG + Intronic
917516479 1:175712697-175712719 CAGAAGCAAGAGAGAGAGGGTGG - Intronic
917563725 1:176188276-176188298 TAGAATAAAGAAAGAAGGGCTGG + Intronic
917770155 1:178268624-178268646 GAAAAAAAAGAGAGAGAGGAGGG + Intronic
917968524 1:180193377-180193399 CAGAGGAGAGAGAGAGAGGCAGG + Intronic
918003459 1:180520145-180520167 CAGAAAAAAGTGAGAGAGATGGG + Intergenic
918094170 1:181321061-181321083 GAGAAGCAAGAGAGAGAGGAGGG + Intergenic
918563769 1:185901294-185901316 AAGAAGAAAGAGAGAGAGTTGGG - Intronic
918781532 1:188705766-188705788 CAGAATAAAGAGAAATCGGGTGG - Intergenic
918842965 1:189567994-189568016 CAGAGGAAAGAAAGAGTGGCAGG + Intergenic
919176685 1:194028160-194028182 CAGAATAAAGAGCCTGAGCCAGG - Intergenic
919679260 1:200418198-200418220 CAGAAACAAGTGAGACAGGCTGG + Intergenic
919745773 1:201008388-201008410 CAGAAGGAAGGGAGAGAGCCAGG + Intronic
919846094 1:201643143-201643165 GGGAAGAAAGAGAGAGAGGAAGG - Intronic
919884578 1:201924018-201924040 AAGAAAAGAAAGAGAGAGGCTGG + Intronic
919899434 1:202033176-202033198 AAAAAAAAAGAGAGAGAGACTGG - Intergenic
919950788 1:202361410-202361432 CAGGAGAAAGAGAGAGAGGTGGG + Intronic
920133889 1:203754064-203754086 AAGAAGAAAGAGAGAAAGGAAGG + Intergenic
920228201 1:204453111-204453133 CAGATTAAAGAGACTGAGGAGGG - Intronic
920364253 1:205439837-205439859 CAAAATGAAGGGAGAGAGGAAGG + Intronic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
921018873 1:211217830-211217852 CAAAATAAGGATGGAGAGGCAGG + Intergenic
921047131 1:211485482-211485504 AAGAACAGAGACAGAGAGGCAGG + Intronic
921283435 1:213588593-213588615 TAGTATTAAGAGACAGAGGCCGG - Intergenic
922127631 1:222744017-222744039 CAGAAAAAAGAGAGAGACCTAGG - Intronic
922463888 1:225833497-225833519 TTAAAAAAAGAGAGAGAGGCTGG + Intronic
922660552 1:227426386-227426408 CAGGAGCAAGAGAGAGAGGGCGG + Intergenic
922752172 1:228075408-228075430 CAGATTTGAGAGAGAGAGTCGGG - Exonic
923429969 1:233910493-233910515 CAGAATAGAGAGAGAAGTGCTGG + Intronic
923525925 1:234772721-234772743 CAGAATAAACAAAGAGATGCTGG - Intergenic
923621286 1:235581548-235581570 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
924183902 1:241466680-241466702 CAGAAGGAAGAGAGAGAGGGAGG + Intergenic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924692429 1:246363946-246363968 AGAAAAAAAGAGAGAGAGGCAGG + Intronic
1062876966 10:950632-950654 CTAAATAAAGAGAGAGACGCAGG - Intergenic
1062880177 10:972014-972036 AAAAATAAAGAGAGAGAGAGAGG - Intergenic
1063218093 10:3942219-3942241 AAAGAAAAAGAGAGAGAGGCAGG + Intergenic
1063225646 10:4013062-4013084 GAGAAAAGAGAGAGAGAGGGAGG - Intergenic
1063375023 10:5549179-5549201 CAGAAGTAAGAGAGAAAGGAAGG + Intergenic
1063400218 10:5736423-5736445 AAAAAAAAAGAGAGAGAGACGGG + Intronic
1063574160 10:7246422-7246444 CATAAGAATGTGAGAGAGGCCGG + Intronic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1063714399 10:8513428-8513450 AAGAAGAAAGAGAGAGAGAGAGG - Intergenic
1063735284 10:8746748-8746770 GAGAAGACAGAGAGGGAGGCTGG + Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064002621 10:11676108-11676130 CAGGAGGAAGAGAGCGAGGCAGG - Intergenic
1064119622 10:12607223-12607245 AAGAAGAAAGGGAGGGAGGCCGG - Intronic
1064337502 10:14457269-14457291 TAAAATAAAGAGGGAGAGGTGGG - Intronic
1064363520 10:14686814-14686836 CAAATTGAAGAGAGAGGGGCAGG + Intronic
1064464217 10:15563058-15563080 CAGAACCAAGAGAGAGAGGGTGG - Intronic
1064666928 10:17662957-17662979 CAAAGTGAAGAGAGAGAGGAGGG - Intronic
1064723622 10:18255239-18255261 GAGAATAAAGTAAGAGAGGGAGG - Intronic
1064865700 10:19877184-19877206 TAGAATGAGGAGAGAGAGGGAGG + Intronic
1064880253 10:20044131-20044153 AAGGAAAAAGAGAGAGAGGGAGG - Intronic
1064929195 10:20604818-20604840 CAGAAAAAAGAAAGAAAGGAAGG + Intergenic
1065059868 10:21889200-21889222 CAGAAACGAGAGAGAGAGGGAGG + Intronic
1065176923 10:23086540-23086562 CAGAAGGAAGAGAGAGAGGTGGG + Intergenic
1065184229 10:23156749-23156771 GAAAAGAAAGAGAGAGAGGATGG + Intergenic
1065355828 10:24840594-24840616 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1065437261 10:25716329-25716351 CAGAAGGAAGAAAGGGAGGCAGG + Intergenic
1065734596 10:28740234-28740256 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1065738536 10:28775730-28775752 CAGGAGGAAGAGAGAGAGGCAGG + Intergenic
1065770514 10:29074036-29074058 AAGAAGAAAGAAAGAGAGGGAGG + Intergenic
1066346191 10:34589044-34589066 TAGTAGAAAGAGAGAGAGACAGG - Intronic
1066350207 10:34630430-34630452 AAAAAAAAAGAGAGAGAGGGAGG - Intronic
1066418237 10:35240832-35240854 AAATATAAAGAGGGAGAGGCCGG + Intergenic
1066499027 10:35972180-35972202 CAGGAGCAAGAGAGAGAGGTAGG + Intergenic
1066525785 10:36277715-36277737 AAGAAGAAAGAGAGAGAGAATGG + Intergenic
1066608517 10:37209416-37209438 CAGGAGCAAGAGAGAGAGGTGGG + Intronic
1066676182 10:37889891-37889913 CAGGAAGAAGAGAGAGAGGTGGG + Intergenic
1067021158 10:42799400-42799422 GAGAATAGAGAGAAAGGGGCTGG - Intronic
1067191676 10:44075109-44075131 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1067385412 10:45813925-45813947 GAGAAGAAAGAGAGAGGGCCAGG + Intergenic
1067449734 10:46375021-46375043 GAGAAGAAAGAGAGAGGGCCAGG - Intergenic
1067634763 10:47993843-47993865 GAGAAGAAAGAGAGAGGGTCAGG + Intergenic
1067714234 10:48674223-48674245 TTGAAAAAAGAGAGAGAGGCTGG - Intergenic
1067995049 10:51262757-51262779 CAGAAAAGAGAGAGAGAGAAGGG + Intronic
1068278801 10:54839557-54839579 CAGAAAAAGGAGAGAGAGAAGGG + Intronic
1068460895 10:57327000-57327022 GAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1068830695 10:61491521-61491543 AGGAAGAAAGGGAGAGAGGCAGG + Intergenic
1069200383 10:65607772-65607794 AAGAAAGAAGAGAGAGAGGGAGG - Intergenic
1069282788 10:66676585-66676607 AGGGAGAAAGAGAGAGAGGCAGG - Intronic
1069644526 10:69983451-69983473 AAGAAAAGAGAGAGAGAGGGTGG + Intergenic
1070001150 10:72378427-72378449 CAGGAGGAAGAGAGAGAGGTGGG - Intronic
1070131690 10:73660281-73660303 GAGAAGAAAGAGAGAGGGCCAGG + Intronic
1070144620 10:73764769-73764791 CAGCATGAAGAGAGCGAGCCAGG + Intronic
1070324309 10:75377982-75378004 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1070350086 10:75583428-75583450 CAGAAGGAAGAGAGAGAGAAGGG + Intronic
1070379586 10:75868773-75868795 CAGGATGGAGAGAGAGAGGAGGG - Intronic
1070394896 10:76003382-76003404 CAGAAGGAAGGGAGAGAGGATGG - Intronic
1070694037 10:78548614-78548636 GAAAAAAAAGAGAGAGAGGAAGG + Intergenic
1070698867 10:78584383-78584405 CAGGAGAAAGACACAGAGGCAGG + Intergenic
1071699363 10:87913666-87913688 CAGAATAAAAAGAGAGAAAAGGG - Intronic
1072127364 10:92458794-92458816 CAAAAAAAAGAGAGAGGGGCTGG - Intronic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072612043 10:97023952-97023974 AAGAAAAGAGAGAGAGAGGAAGG + Intronic
1072767257 10:98105597-98105619 GAGAATAAAGCCATAGAGGCAGG - Intergenic
1073027384 10:100497913-100497935 TAGAGTAGAAAGAGAGAGGCAGG + Intronic
1073311756 10:102547807-102547829 GGAAAGAAAGAGAGAGAGGCGGG + Intronic
1073407585 10:103311436-103311458 AAAAAAAAAAAGAGAGAGGCCGG - Intronic
1073416957 10:103391802-103391824 CAAAAAAAAGAAAAAGAGGCTGG - Intronic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1073748881 10:106501274-106501296 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
1073753030 10:106551190-106551212 AAGAAAAGAGAGAGAGAGGAAGG + Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074905702 10:117861711-117861733 CAGGAGCAAGAGAGAGAGTCGGG + Intergenic
1074953771 10:118367412-118367434 AAAAAGAAAGAGAGAGAGGGAGG + Intergenic
1074969651 10:118525630-118525652 CAGGAGGAAGAGAGAGAGGAAGG - Intergenic
1075553542 10:123412139-123412161 CAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1075557600 10:123444704-123444726 GAGGAAAAAGAGAGAGAGACAGG + Intergenic
1075694832 10:124426436-124426458 AAGAAAAAAGAGAGAAAGGAAGG - Intergenic
1076053995 10:127356605-127356627 CATGAGAGAGAGAGAGAGGCAGG + Intronic
1076188243 10:128465162-128465184 CTGAATCAAGAGATAGAAGCCGG - Intergenic
1076194597 10:128508112-128508134 AGGAGGAAAGAGAGAGAGGCTGG + Intergenic
1076382197 10:130031664-130031686 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1076605394 10:131686000-131686022 GGAAAGAAAGAGAGAGAGGCCGG + Intergenic
1076637823 10:131893881-131893903 CAGAAAAAAGAAAGGGAGGTAGG - Intergenic
1076758445 10:132587582-132587604 AACAACAAAGAGGGAGAGGCTGG - Intronic
1077101105 11:822807-822829 AAAAAAAAAGAGAGAGAGACTGG - Intronic
1077288735 11:1779154-1779176 CAGAGCCAACAGAGAGAGGCAGG - Intergenic
1077837661 11:5938452-5938474 GGGAAAAAGGAGAGAGAGGCGGG + Intronic
1077842566 11:5991419-5991441 GAGATTAAAGAGAGAGGGACAGG + Intergenic
1077996699 11:7458752-7458774 GAGAAAAAAGAGAGAGAAGTAGG + Intronic
1078007148 11:7540506-7540528 GAGAATATAGAGAGGGAGGTGGG + Intronic
1078144816 11:8715527-8715549 CAGGAAAGAGAGAGAAAGGCTGG + Intronic
1078277474 11:9863741-9863763 AAAAAAAAAGAGAGAGAGGGAGG - Intronic
1078393228 11:10954762-10954784 CAGAAGAAAGAGAGAGGGAAGGG - Intergenic
1078667975 11:13341723-13341745 CAGAATAAGAGGAGAGAGCCTGG - Intronic
1078736590 11:14025901-14025923 AAGAACAAAGAGAGAGAAACAGG - Intronic
1078873900 11:15375180-15375202 AAGAAGGAAGAGAGAGAGGGAGG - Intergenic
1078916372 11:15782481-15782503 CAGAGTAATGGGATAGAGGCAGG + Intergenic
1078925747 11:15873308-15873330 CAGAATAGAGAGAGAGAGAATGG + Intergenic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079178758 11:18169652-18169674 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
1079270076 11:18976265-18976287 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1079601425 11:22316346-22316368 CAGGGGAGAGAGAGAGAGGCGGG - Intergenic
1079601467 11:22316515-22316537 GGGAAGAGAGAGAGAGAGGCGGG - Intergenic
1079601533 11:22316748-22316770 CAGGGGAGAGAGAGAGAGGCAGG - Intergenic
1079719133 11:23788783-23788805 CATAATAAAGAAAAAGAGGAAGG + Intergenic
1079739462 11:24038432-24038454 CAGGAGCAAGAGAGAGAGGGTGG + Intergenic
1079758458 11:24297264-24297286 TACAATAAAGAGAGAAAGGCAGG + Intergenic
1079992027 11:27256270-27256292 CAGGAGAAAGAGAGAGAAGTAGG + Intergenic
1080318150 11:30973301-30973323 CAGGAGGAAGAGAGAGAGGGGGG - Intronic
1080704337 11:34675837-34675859 CAGAAAAAAGAGAGAGAACATGG - Intergenic
1080715336 11:34794628-34794650 CAGAATATCGAGAGAGAAGCAGG + Intergenic
1080812189 11:35715843-35715865 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1080962807 11:37180268-37180290 CAGAATAAAGATAAAAAGTCTGG - Intergenic
1081642216 11:44764038-44764060 CAGGAGAAAGAGAGAGAGAGGGG + Intronic
1081783808 11:45732425-45732447 CAGGAGGAAGAGAGAGAGGGTGG + Intergenic
1081924866 11:46817119-46817141 AAAAAAAAAGAGAGAGAGACAGG + Intronic
1081950974 11:47042215-47042237 TAAAATAAAGAAAGAGAGGAAGG + Intronic
1082055461 11:47811489-47811511 AAAAAAAAAGAGAGAGAGACAGG + Intronic
1082672225 11:56047629-56047651 AAGAAGAAAGAGAGGGGGGCAGG - Intergenic
1082814175 11:57497399-57497421 CTGAATAAAGCCAGAGAGTCAGG + Intronic
1083063288 11:59897301-59897323 GATATGAAAGAGAGAGAGGCAGG - Intergenic
1083112541 11:60425602-60425624 CAGAATAAAGAGAGATACTTTGG - Intergenic
1083788412 11:64968110-64968132 GAGAATGAAGAGAGAGAGGAGGG + Intronic
1084115718 11:67041883-67041905 GAGAATAAAGCGTGAGGGGCAGG + Intronic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1084537572 11:69766537-69766559 AAGGAAAGAGAGAGAGAGGCTGG + Intergenic
1086589416 11:88494566-88494588 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1086911940 11:92482735-92482757 CACAAAAGAGAGAGAGAGACTGG - Intronic
1086954987 11:92926347-92926369 AAGAAAAGAGAGAGAGAGGAGGG - Intergenic
1087069786 11:94066560-94066582 GAAAAAAAAGAGAGAGAGACTGG + Intronic
1087486819 11:98767773-98767795 GAGAATAAACAGGGACAGGCTGG - Intergenic
1087684367 11:101246398-101246420 GAGAGAAGAGAGAGAGAGGCAGG + Intergenic
1087916930 11:103821984-103822006 GGGAAGAAAGAGAGAGAGGTTGG - Intergenic
1088073745 11:105821529-105821551 CAGGAGCAAGAGAGAGAGGGCGG + Intronic
1088079057 11:105888179-105888201 TATAATAAAGCAAGAGAGGCTGG - Intronic
1088174033 11:107030767-107030789 CAGAGGAAAGAGAGAAAGACAGG + Intergenic
1088181655 11:107120180-107120202 CAGAAAAAGGAGAGAGAGTAAGG + Intergenic
1088412240 11:109547352-109547374 CATAAGAAAGAGAGGGAGACAGG - Intergenic
1088545513 11:110954972-110954994 CAGAAGCAAGAGAGTGAGGTGGG + Intergenic
1089176470 11:116552306-116552328 GGGAGGAAAGAGAGAGAGGCAGG + Intergenic
1089415252 11:118283771-118283793 GAGAATAGAGAGAGAGATGGGGG - Intergenic
1089644923 11:119872639-119872661 CAGAAGAAAGAGGGAAAGTCTGG - Intergenic
1090201708 11:124862321-124862343 CAGAAAGAAGAGAGAGTAGCAGG - Intergenic
1090259595 11:125309167-125309189 AGGAAGAAAGAGAGAGAGGAAGG - Intronic
1090394416 11:126409230-126409252 CAGAAGAGAGAGACAGAAGCGGG - Intronic
1090395646 11:126416394-126416416 CAGAAAAAGGCGACAGAGGCTGG - Intronic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090603432 11:128396095-128396117 TAGAACAAAGAGACAGAGGGAGG + Intergenic
1090721082 11:129473823-129473845 CAGAATAATCAGGGAGAGGGAGG + Intergenic
1090736743 11:129617480-129617502 CAGGAGAAAGAGAGAGTGGCAGG - Intergenic
1090883425 11:130854797-130854819 CCGAAGAAAGAGACAGAGACTGG - Intergenic
1090979962 11:131710994-131711016 GAGAATAAGGAGAGAGAAGAAGG - Intronic
1091061591 11:132468099-132468121 AAGCAGAAAGAGAGGGAGGCTGG - Intronic
1091094759 11:132810143-132810165 CAGAAGACGGAGGGAGAGGCTGG - Intronic
1091241186 11:134053544-134053566 AAGAATAAACAGCAAGAGGCAGG + Intergenic
1091420673 12:337126-337148 CAGGAGGAAGAGAGAGAAGCGGG - Intronic
1091471315 12:730609-730631 CAGAAGGAAGAGAGAGAGTTGGG + Intergenic
1091533474 12:1383229-1383251 CAGAAGAAACAGGGAGAGGAGGG - Intronic
1091631134 12:2161758-2161780 CAGACTAAAGAAAGCCAGGCTGG + Intronic
1091642466 12:2247807-2247829 GAGAATAAAGAGAAAGGAGCAGG - Intronic
1091652837 12:2322646-2322668 CAGAAGGAAGGGAGAGAGGGAGG - Intronic
1091978203 12:4843735-4843757 CAGAAGCAAGAGAGCGAGGTGGG + Intronic
1092076086 12:5674721-5674743 CAGAATCAAGTGACAGAGACAGG - Intronic
1092097903 12:5859527-5859549 AAAAAAAAAGAGAGAGAGACCGG - Intronic
1092118774 12:6029044-6029066 CAAAATAAAGGGAGGGAGGAAGG + Intronic
1092138875 12:6168867-6168889 CAGAATAACAAGAGAAAGTCTGG + Intergenic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092736692 12:11589461-11589483 AAGAAGAAAGGGAGTGAGGCTGG - Intergenic
1092776374 12:11948143-11948165 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1092808367 12:12248774-12248796 AAGAATAAAGACTGAGAGGCTGG - Intronic
1092811609 12:12276116-12276138 CAGGAGAAAGAGAGAGAGTGAGG + Intergenic
1093204661 12:16232971-16232993 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093528526 12:20133866-20133888 CAGAAAGAACAGAGAGGGGCAGG + Intergenic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1094268601 12:28586636-28586658 GAGAATAAACAGAGACAGGTAGG - Intergenic
1094348998 12:29502407-29502429 CAAAATAAAGATAGAGATGTAGG + Intronic
1094372258 12:29751318-29751340 AAGAGCAGAGAGAGAGAGGCAGG + Intronic
1094544173 12:31388974-31388996 CAGAAAAATGAGACAGAGCCAGG - Intronic
1094570514 12:31637416-31637438 AAGAAAAAAGAAAGAGAGGAAGG - Intergenic
1095188718 12:39231557-39231579 CAGAAGAGAGAGAGAGAGCAAGG - Intergenic
1095311692 12:40705864-40705886 CAGGATCAAGAGAGAGTGGCGGG + Intronic
1095443372 12:42260190-42260212 AAGAAAGAAGAGAGAGAGGAAGG + Intronic
1095528603 12:43157946-43157968 CAGAAGCAAGAGAGAGAGCGGGG + Intergenic
1095610523 12:44122338-44122360 CACAAAAAAGAAAAAGAGGCTGG - Intronic
1095817573 12:46441254-46441276 AAAAATAAAGAGAGAGAGGGAGG - Intergenic
1095824746 12:46519461-46519483 GAGAAGAAAGAAAAAGAGGCAGG - Intergenic
1095883334 12:47162646-47162668 AACAAGAAAGAGAGAGAGGAGGG + Intronic
1096050736 12:48605408-48605430 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
1096051013 12:48607436-48607458 CAGAAGGAAGAGAGAGAGGGAGG + Intergenic
1096136520 12:49206954-49206976 AAAAAGAAAGAGAGAGAGGCCGG + Intronic
1096160377 12:49371735-49371757 CAGGAGGAAGAGAGAGAGGTGGG + Intronic
1096261581 12:50095744-50095766 CAGAGAAGAGAGAGAGAGCCTGG + Intronic
1096354508 12:50928901-50928923 CAGCATAAAGGAGGAGAGGCAGG - Intronic
1096521576 12:52187488-52187510 CAGAGCAGAGAGAGAGGGGCTGG - Intronic
1096565821 12:52477950-52477972 CAGAAGGAAGAGAGAGAGAAGGG - Intergenic
1096720258 12:53516090-53516112 GGGAATGAAGAGAGAGAAGCAGG + Exonic
1097081838 12:56437514-56437536 CAGAATACAGAAAATGAGGCAGG + Intronic
1097279323 12:57834824-57834846 CAGAACAAAAAAACAGAGGCTGG + Intronic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1097958745 12:65512292-65512314 CAGAATACACAGGGAGAGGGAGG - Intergenic
1098465078 12:70777680-70777702 CAGAAGGAAGAAAGAGAGGGTGG - Intronic
1098951094 12:76641229-76641251 AAGAAAGAAGAGAGAGAGGGAGG - Intergenic
1099126170 12:78760993-78761015 CAGGAGACAGAGAGAGAGGGAGG + Intergenic
1099383097 12:81979857-81979879 CAGGAGAAAGAGAGAGACGGTGG + Intergenic
1100291301 12:93217282-93217304 TAAATTAAAAAGAGAGAGGCTGG + Intergenic
1100559977 12:95738521-95738543 GTGAACAAAGAGAGAGTGGCTGG + Intronic
1100787003 12:98089324-98089346 TAGAATAAAGTGAATGAGGCAGG - Intergenic
1101387120 12:104267842-104267864 AAAAAAAAAGAGAGAGAGGAAGG - Intronic
1101396786 12:104355819-104355841 CAGAACAGGGAGAGAGGGGCAGG + Intergenic
1101494271 12:105238595-105238617 CAGGAGTAAGAGAGAAAGGCAGG + Intronic
1101787787 12:107900836-107900858 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
1102153287 12:110703681-110703703 CAAAAAAAAAAGAGAGAGGCGGG - Intronic
1102205552 12:111088388-111088410 CAGAAAGAATACAGAGAGGCTGG - Intronic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102775108 12:115511829-115511851 AAGAAAGAAGAGAGAGAGGAAGG + Intergenic
1102872116 12:116422047-116422069 CAGAAGAGAGATACAGAGGCTGG - Intergenic
1102974218 12:117194849-117194871 CAAAGAAAAGAGAGAGAGGAAGG - Intergenic
1103199301 12:119073619-119073641 CTCAAAAAAGAGAGAGAGGCCGG - Intronic
1103317610 12:120069138-120069160 AAAAATCAAGAGAGAGAGGCTGG + Intronic
1103612913 12:122134968-122134990 TAAAAAAAAGATAGAGAGGCTGG - Intronic
1103686100 12:122733209-122733231 AAAAAGAAAGAGAGAGAGGGAGG - Intergenic
1103835631 12:123818241-123818263 AAAAATAAAGAGATAGAGGCTGG - Intronic
1103958956 12:124595503-124595525 AAGAAGAAAGGGAGAGAGGGAGG + Intergenic
1104016117 12:124963571-124963593 CAGAATAAAGAAACAGTGGCCGG + Intronic
1104374381 12:128250953-128250975 CAGAAAGAAGAAAGAGAGGAGGG + Intergenic
1104631958 12:130410320-130410342 CAGAATAAAAAGCCACAGGCTGG - Intronic
1104872196 12:132007899-132007921 TAGCTTAAGGAGAGAGAGGCAGG + Intronic
1105275332 13:18918148-18918170 AAAAAAAAAGAGAGAGAGACTGG - Intergenic
1105592849 13:21810653-21810675 CAGAAGAAGGAGAGACAGCCAGG + Intergenic
1105651896 13:22387905-22387927 GAGAGAAGAGAGAGAGAGGCTGG - Intergenic
1106063559 13:26320648-26320670 CAGAATAAATAGAGAGCTCCTGG + Intronic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1106474679 13:30088525-30088547 CAGGAGGAAGAGAGAGAGGGGGG + Intergenic
1106698751 13:32206496-32206518 AAGAATGTAGAAAGAGAGGCTGG + Intronic
1107364077 13:39651340-39651362 AAGAAAAAAGAAAGAGAGGGAGG - Intergenic
1107376149 13:39806909-39806931 CAGATTAGAGAGAGAGAAGGTGG - Intergenic
1107403464 13:40091679-40091701 GAGAAAAGAGAGAGAGAGGGAGG - Intergenic
1107582700 13:41808447-41808469 CAGGAGAAAGAGAGAGAGGCAGG + Intronic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107749142 13:43545585-43545607 CAGAAAACAGGGAGAGAGGCAGG - Intronic
1107788475 13:43977710-43977732 CGGAAGAGAGAGAGAGAGGGAGG - Intergenic
1107933229 13:45323724-45323746 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1107992774 13:45833031-45833053 CAGAAAACAGAGACAGAGGTGGG + Intronic
1108350208 13:49585158-49585180 CTCAAAAAAGAGAGGGAGGCAGG + Intronic
1108632094 13:52294800-52294822 AAAAATAAAGAGATAGAGGCCGG + Intergenic
1108654606 13:52517794-52517816 AAAAATAAAGAGATAGAGGCCGG - Intergenic
1108823162 13:54378569-54378591 AAGAAGAGAGAGAGAGAGGAGGG - Intergenic
1108840215 13:54604008-54604030 CAAAAAAAAAAGAGAGAGGACGG - Intergenic
1108851128 13:54730671-54730693 TAGAATAAAAAGACAGAGGGAGG - Intergenic
1108984868 13:56574058-56574080 AAGAAACAAGAGAGAGTGGCAGG - Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109910427 13:68904362-68904384 CAGAAGCAAGAGAGAGAGAGGGG - Intergenic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1110159945 13:72363818-72363840 CAGAGTAAAGAGAGAGAAACTGG - Intergenic
1110215018 13:73015354-73015376 CAGAATAGAAAGAAAAAGGCAGG - Intronic
1110240261 13:73258894-73258916 CAGAAGATAGAGGGAGAGGAGGG + Intergenic
1110379918 13:74838925-74838947 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1110464606 13:75786679-75786701 GAAAATAAGTAGAGAGAGGCCGG - Intronic
1110678603 13:78280836-78280858 CAGAATTAATTTAGAGAGGCGGG - Intergenic
1110714405 13:78684652-78684674 CAGAATAAAGAAAATCAGGCTGG - Intergenic
1110744434 13:79036383-79036405 AAGAAAAAAGGGAGGGAGGCAGG + Intergenic
1111365618 13:87239095-87239117 AGGAAGAAAGAGAGAGAGGGAGG + Intergenic
1111656513 13:91160921-91160943 CAGGAGGAAGAGAGAGAAGCAGG - Intergenic
1111813594 13:93122173-93122195 CAGAAGAGAGAGAGAGAGGGTGG - Intergenic
1111976797 13:94974855-94974877 CAGGATTAAGAAAGACAGGCAGG + Intergenic
1112038163 13:95517026-95517048 AAGAAAAAAGGGAGAGAGGGAGG - Intronic
1112110017 13:96286003-96286025 AAGAAGAAAGAGAGAAAGGGAGG - Intronic
1112310031 13:98310021-98310043 AGGAATAGAGAGAGAGAGGATGG - Intronic
1112744833 13:102514825-102514847 AAGAAGAAAGAGAGAGGGGTAGG + Intergenic
1113069725 13:106408888-106408910 CACAATAAAGAGAGAGACAGGGG - Intergenic
1113224032 13:108139883-108139905 CAGAATGAAGAGTGAGTGGAGGG + Intergenic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113392163 13:109908308-109908330 CAGAAAAGAGAGAGAGAAGAGGG + Intergenic
1113674103 13:112196303-112196325 AGGAATGAAGAGAGAGAGGAAGG - Intergenic
1113814421 13:113161548-113161570 CAGAAGGAAGCGGGAGAGGCAGG + Intronic
1114248716 14:20938455-20938477 CAGAAGCAAGAGAGAGAGGGAGG - Intergenic
1114339156 14:21724680-21724702 AGAAAGAAAGAGAGAGAGGCAGG - Intergenic
1114409445 14:22486878-22486900 AAAACTACAGAGAGAGAGGCGGG + Intergenic
1114562187 14:23601367-23601389 TAGAGTGAAGAGAGGGAGGCTGG - Intergenic
1114803896 14:25811709-25811731 CAGAATAGAGTGAGGGGGGCTGG - Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1115197468 14:30816867-30816889 GTGAAGAAAGAGAGAGAGGTAGG - Intergenic
1115286145 14:31714534-31714556 CAGAAGGAAGAGAGACAGGCGGG + Intronic
1115495764 14:34003003-34003025 AAGAAAAAAAAGAGAGAGACGGG + Intronic
1115556094 14:34546235-34546257 GAGAAGAGAGAGAGAGAGACAGG - Intergenic
1115557814 14:34556846-34556868 GAGAAGAGAGAGAGAGAGACAGG + Intergenic
1115802324 14:37009087-37009109 AAGAATAAAGAGAGAGATGGTGG - Intronic
1115812460 14:37124835-37124857 CAGGAGCAAGAGAGAGAGGTAGG - Intronic
1115998006 14:39213633-39213655 CAGAAAAAAGACATAGAGGCTGG + Intergenic
1116202528 14:41816697-41816719 CAGAATAAAGAGACAAAGTTTGG - Intronic
1116202734 14:41819657-41819679 CAGGAGAAAGAGAGAGAGAGAGG + Intronic
1116422247 14:44745733-44745755 CAGAATAGAGAGAGAGACTTTGG + Intergenic
1116507184 14:45698588-45698610 CAGAAGCAAGAGAGAGAAGAGGG - Intergenic
1116762799 14:49035604-49035626 AAAAGTGAAGAGAGAGAGGCAGG + Intergenic
1117105448 14:52393762-52393784 GAGAATAAAAAAAGAGAGGTGGG - Intergenic
1117141709 14:52796306-52796328 CAAAAAAAAGAAAGAGGGGCCGG + Intergenic
1117255449 14:53972619-53972641 GACAATAAAGAGAGGGAGGAAGG + Intergenic
1117389245 14:55247442-55247464 GAGATTAAAGAGAGAGAGAGAGG + Intergenic
1117666205 14:58058984-58059006 CAGAATAGAAAGAGAGATGTTGG + Intronic
1117964134 14:61189524-61189546 CAGAAGCAAGAGAGAGAGGAAGG - Intronic
1118016948 14:61670364-61670386 CAGTATTAAGTGAGAGAGACTGG + Intergenic
1118268388 14:64317466-64317488 CAGAAGCAAGATAGAGAGACAGG + Intronic
1118660637 14:68005962-68005984 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1119026375 14:71156071-71156093 AAAAAAAAAGAGAGAGAGGGAGG - Intergenic
1120306813 14:82781139-82781161 TAGAATAAGGAAGGAGAGGCCGG - Intergenic
1120464078 14:84833693-84833715 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1120571561 14:86124138-86124160 GAGACTGAAGAGACAGAGGCTGG + Intergenic
1120584243 14:86291319-86291341 GAGAAGAAAGAAAGAGAGGGAGG - Intergenic
1120596943 14:86451864-86451886 AAGAAAAAAGAAAGAGAGGAAGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120662599 14:87268348-87268370 CAGAATTAAGAGCGAGAGTGTGG + Intergenic
1120873792 14:89360579-89360601 AAGAAGAAAGGGAGAGAGGGAGG + Intronic
1120902520 14:89588160-89588182 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
1120959703 14:90113634-90113656 TAGAAGAAACTGAGAGAGGCCGG + Intronic
1121077514 14:91081705-91081727 AAAAATAAAGAAACAGAGGCTGG - Intronic
1121347604 14:93147644-93147666 GCGAATAAAGAGAGAGAGAAGGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121870106 14:97399600-97399622 CAGGAGAGAGAGAGAGAGGTGGG + Intergenic
1121894969 14:97638301-97638323 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1122009908 14:98737431-98737453 CAGAACAAAGAGGGAGAGTCAGG + Intergenic
1122216651 14:100208942-100208964 TAAAAAAAAGAGAGAGAAGCAGG - Intergenic
1122730363 14:103792772-103792794 CAAAAAAAAGAAAAAGAGGCTGG + Intronic
1123462757 15:20488657-20488679 CAGATAAGAGAGAGAAAGGCCGG - Intergenic
1123586074 15:21761794-21761816 CAGAATCAAGTGACAGAGACAGG + Intergenic
1123622716 15:22204384-22204406 CAGAATCAAGTGACAGAGACAGG + Intergenic
1123655303 15:22511762-22511784 CAGATAAGAGAGAGAAAGGCCGG + Intergenic
1123786079 15:23674963-23674985 CAGAACCAGGAGAGAGAGGAAGG - Intergenic
1123801531 15:23826149-23826171 CAAAATATGGAGAGACAGGCAGG - Intergenic
1124110200 15:26778147-26778169 CAGGAGGAAGAGAGAGAGGAGGG + Intronic
1124273446 15:28304658-28304680 CAGATAAGAGAGAGAAAGGCCGG - Intronic
1124301122 15:28544854-28544876 AAAAAAAAAGAGAGAGAGACCGG + Intergenic
1124309213 15:28606963-28606985 CAGATAAGAGAGAGAAAGGCCGG + Intergenic
1124470371 15:29978930-29978952 GAGAAGAAAGAGAGAGAGAGAGG + Intergenic
1124521236 15:30407965-30407987 CACATTAAAGAAAGAGAAGCAGG - Exonic
1125138240 15:36369331-36369353 CAGAACCAAGTGAGAAAGGCTGG - Intergenic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1125708934 15:41767757-41767779 AAGAATAGGGAGAGAGAGGATGG + Exonic
1125798855 15:42426403-42426425 AAAAAAAAAGAGAGAGAGACAGG + Intronic
1126404998 15:48314536-48314558 CATAAAAAAAAGAGTGAGGCTGG - Intergenic
1126490776 15:49233244-49233266 CAGGAGGAAGAGAGAGAGGTGGG + Intronic
1126907465 15:53383525-53383547 CAGAAGCAAGAGAGAGAGGAGGG + Intergenic
1127053240 15:55106414-55106436 CAGAAGAAAGAGAGAGTGAGGGG - Intergenic
1127102046 15:55576472-55576494 AAAAAAAAAAAGAGAGAGGCCGG + Intronic
1127526133 15:59793248-59793270 GAGAGGAGAGAGAGAGAGGCAGG + Intergenic
1128123569 15:65173071-65173093 ATGAATAAAGAAAGACAGGCTGG + Intronic
1128414172 15:67428859-67428881 AAAAAGAGAGAGAGAGAGGCAGG + Intronic
1128478368 15:68016550-68016572 CAGGAGGAAGAGAGAGAGGCAGG - Intergenic
1128535066 15:68484462-68484484 AGGAAGAAAGAGAGAGAGGGAGG + Intergenic
1128727922 15:70001457-70001479 GGGAAGAAAGAGAGAGAGGGAGG + Intergenic
1128916690 15:71569311-71569333 AAGAAGAAAGAGAGAGAGAGAGG + Intronic
1129189953 15:73931339-73931361 CAGACTGAAGAGGGAGAGACTGG - Intronic
1129452747 15:75659915-75659937 CAGAAAGAAAAGAGAGAGGAGGG - Exonic
1129880962 15:79005754-79005776 AAAAATAAAGGGAGAGAGGAAGG - Intronic
1129911472 15:79230948-79230970 CAGAAGCAAGAGAGAGAGAGAGG + Intergenic
1129927256 15:79375613-79375635 CAGAAGCAAGAGAGAGAGGGAGG + Intronic
1129972092 15:79787754-79787776 GAGAAGAAAGAAAGAGAGGAAGG - Intergenic
1129991271 15:79965522-79965544 CAGAGTCAAGTGAGAGAGGAAGG + Intronic
1130078374 15:80709691-80709713 GAGAACAATGAGGGAGAGGCCGG - Intronic
1130137599 15:81195169-81195191 CGGAAAATAGAGGGAGAGGCGGG + Intronic
1130684779 15:86027372-86027394 AAGAATAGAAAGAGTGAGGCAGG - Intergenic
1130726965 15:86449150-86449172 GAAAATAAATAGAGATAGGCTGG + Intronic
1131424628 15:92335422-92335444 CAGAAAAAGAAGAGAGAGGGAGG - Intergenic
1131439747 15:92450578-92450600 CAGGAGCAAGAGAGAGAGGGAGG + Intronic
1131468909 15:92678709-92678731 CAGAATAAAGACATAGAAGGTGG - Intronic
1131483022 15:92798212-92798234 AAAAAGAGAGAGAGAGAGGCAGG + Intronic
1131561762 15:93449807-93449829 CAGAACAAAGAGGCAGAGGATGG - Intergenic
1131692129 15:94838586-94838608 CAGGGTAGAGAGAGAGAGGTGGG + Intergenic
1131709600 15:95038390-95038412 AAGAATAAAAAGAGTAAGGCTGG + Intergenic
1132112978 15:99115872-99115894 GAAAATAAAGACAGTGAGGCCGG - Intronic
1133087080 16:3373281-3373303 AAAAAAAAAGAGAGAGAGGGAGG + Intronic
1133452383 16:5914598-5914620 GAAAAAAAAGGGAGAGAGGCCGG + Intergenic
1133712627 16:8415917-8415939 AAAAATATTGAGAGAGAGGCTGG - Intergenic
1133730130 16:8571743-8571765 CAGAATAGAGCGAGGGTGGCTGG + Intronic
1134097645 16:11429266-11429288 CAGGATTAAGAGAAAGAGGGGGG - Intronic
1134295240 16:12939705-12939727 CACAATAGACAGGGAGAGGCAGG - Intronic
1134605685 16:15569390-15569412 CAGGAGCAAGAGAGTGAGGCGGG + Intronic
1134914423 16:18058067-18058089 CAGGAGCAAGAGAGAGAGACTGG + Intergenic
1135001967 16:18784246-18784268 GAGAAAAAAGAGAGAGAGACAGG - Intronic
1135266924 16:21035028-21035050 CAGAAATAAGAGAGGAAGGCTGG + Intronic
1135640251 16:24113556-24113578 AAGAATGAAAAGAGAGAGGAAGG - Intronic
1135676695 16:24421185-24421207 CAGAAGCAAGAGAGCGAGGCTGG - Intergenic
1135730038 16:24886700-24886722 AAGAATACAGACAGAGAGGTGGG + Intronic
1135821222 16:25688288-25688310 CAGGAGCAAGAGAGCGAGGCAGG - Intergenic
1136361273 16:29781333-29781355 AGGAAGAAAGAGAAAGAGGCTGG + Exonic
1136538186 16:30912800-30912822 AAAAAAAAAGAGAGAGAGACAGG + Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137351224 16:47715481-47715503 AAAAAAAAAGAGAGAGAGACTGG + Intergenic
1137469575 16:48742622-48742644 CTGTATAAAGAAAGGGAGGCAGG + Intergenic
1137502717 16:49023893-49023915 AAGCATAAAGAGAGAGGGGTGGG + Intergenic
1137514328 16:49129969-49129991 AAAAATATAGAGAGAGAGACAGG + Intergenic
1137632955 16:49960327-49960349 CAGAAGAAAGAGCCAGGGGCTGG + Intergenic
1137767417 16:50988637-50988659 GTGAATAATGAGAGAGACGCAGG - Intergenic
1137904766 16:52310004-52310026 CAGAAGACAGAGAGAGAGAGGGG + Intergenic
1137950207 16:52776416-52776438 GAGAATAAAGAAGGAGAAGCAGG + Intergenic
1138160167 16:54745984-54746006 TAAAAGAAAGAGAGAGAGGCTGG + Intergenic
1138292031 16:55856010-55856032 CAGGAGGAAGAGAGAGAGGGAGG - Intronic
1138692089 16:58777581-58777603 CAAAAGGAAGAGAGAGAGGCTGG - Intergenic
1138743089 16:59333287-59333309 CAGAAGAAAGAATGAGAGGGAGG + Intergenic
1138900547 16:61264189-61264211 GAGAAGAAAGGGAGAGAGGTGGG + Intergenic
1139047729 16:63083334-63083356 AAGAAAAGAGAGAGAGAGGAAGG - Intergenic
1139099766 16:63751132-63751154 AACAAGAAAGAGAGAGAGGAGGG - Intergenic
1139256336 16:65546533-65546555 CAGAATTAAGAGATGGGGGCAGG - Intergenic
1139394076 16:66626132-66626154 CAGAATAAAAAGAAAAAGGGAGG + Intronic
1139801661 16:69527757-69527779 AAAAAAAAAGAGAGAGAGGCCGG + Intergenic
1139854611 16:69970476-69970498 AAGAATAAAGAAACTGAGGCCGG + Intergenic
1139883594 16:70193390-70193412 AAGAATAAAGAAACTGAGGCCGG + Intergenic
1140022530 16:71252125-71252147 AAGAATAAATAGCAAGAGGCAGG + Intergenic
1140248980 16:73277891-73277913 CAGGAGCAAGAGAGAGAGGCAGG + Intergenic
1140368917 16:74402126-74402148 AAGAATAAAGAAACTGAGGCCGG - Intergenic
1140395144 16:74620033-74620055 CAGAACAAAGAAACTGAGGCAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140466727 16:75188988-75189010 GAGAAGAAAGGGAGAGAGGAGGG - Intergenic
1140843180 16:78861149-78861171 AGGAAGAAAGAGAGAGAGGGAGG - Intronic
1141017125 16:80461126-80461148 CAGAATCCAGAGAGAGAGAGAGG + Intergenic
1141042661 16:80685152-80685174 CAGAAAACAGAGAGAGAGGGAGG + Intronic
1141108317 16:81251616-81251638 CAGAGTACAGAGGGAGAAGCTGG + Intronic
1141188686 16:81807832-81807854 CAGGAGCAAGAGAGAGAGGGAGG + Intronic
1141224264 16:82100439-82100461 CAGGAGGAAGAGAGAGTGGCGGG + Intergenic
1141232923 16:82187233-82187255 CAGAAGGAAGAGAGACAGGAGGG - Intergenic
1141603089 16:85137849-85137871 AAGAAGAAAAAGAGAAAGGCAGG - Intergenic
1141864266 16:86739358-86739380 AAGAAAGAAGAGAGAGAGGAAGG - Intergenic
1141928246 16:87183317-87183339 CAGGAGCAAGAGAGAGAGCCAGG - Intronic
1142370285 16:89675796-89675818 CAAAATACAGAGGGAGAGTCTGG - Intergenic
1142478265 17:202502-202524 CAGCAGCAAGAGAGTGAGGCGGG + Intergenic
1142913950 17:3118355-3118377 ATGAATAAAGAGACAGAGGCTGG + Intergenic
1143069157 17:4275993-4276015 CAGAAGGAAGAGACAGAGACTGG - Intronic
1143711291 17:8736970-8736992 AAGAAGAAAGAGAGAGAGGGAGG + Intronic
1143720142 17:8803558-8803580 CAGAAGAAAGAGGAAGAGTCAGG + Intronic
1143821137 17:9564347-9564369 GAAAAGAAAGAGAGAGAGGAAGG + Intronic
1143857920 17:9866133-9866155 CAGAAAGAAGTGAAAGAGGCAGG + Intronic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1144232174 17:13218781-13218803 AAGAAAAAAGAGAGAAAGGGAGG - Intergenic
1144274565 17:13653315-13653337 GAGAAGAGAGAGAGAGAGGGGGG - Intergenic
1144550902 17:16240167-16240189 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1145945656 17:28772426-28772448 TAGAAAGAACAGAGAGAGGCCGG + Intronic
1146065031 17:29627939-29627961 GAGAGGAGAGAGAGAGAGGCAGG + Exonic
1146107623 17:30055307-30055329 AAGAAGAGAGAGAGAGAGGAAGG + Intronic
1146154072 17:30505236-30505258 AAGAAATAATAGAGAGAGGCCGG + Intronic
1146174712 17:30658415-30658437 CAAAAAAAAAAGAAAGAGGCTGG + Intergenic
1146185856 17:30723734-30723756 CCCAATAAGAAGAGAGAGGCCGG + Intergenic
1146348172 17:32074426-32074448 CAAAAAAAAAAGAAAGAGGCTGG + Intergenic
1146623120 17:34415627-34415649 AAAAAAAGAGAGAGAGAGGCTGG - Intergenic
1146828562 17:36046613-36046635 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
1147170379 17:38615101-38615123 CAAAAAAAAAAGAGAGAGACAGG - Intergenic
1147527091 17:41235970-41235992 AAGAATAGAGAGAGAGAGAAGGG + Intronic
1147651809 17:42067074-42067096 AAAAAAAAAGAGAGAGAGACAGG + Intergenic
1147769663 17:42858761-42858783 CAGACTCAAGACAGAGATGCAGG + Intergenic
1147826000 17:43270438-43270460 CTGGATAAAGAAAGAGTGGCAGG + Intergenic
1147975656 17:44246889-44246911 CAGGGCAAAGAGAGAGTGGCTGG - Intergenic
1148014207 17:44509597-44509619 CAAAAGAAAGAGAGAGAGGGGGG + Intergenic
1148088999 17:45011467-45011489 AAGAAGAAAGAAAGAAAGGCCGG + Intergenic
1148202384 17:45757896-45757918 AAGAGTAAAGAGAAAGAGCCAGG + Intergenic
1148211690 17:45812717-45812739 AGGAAGAAATAGAGAGAGGCAGG - Intronic
1148271294 17:46263866-46263888 AAAAAAAAAGAGAGAGAGACAGG + Intergenic
1148610884 17:48963857-48963879 AAAAAAAGAGAGAGAGAGGCGGG + Intronic
1148676792 17:49450429-49450451 CAGAAGAAAGAAAGAGAGAGAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148860188 17:50600579-50600601 AGGAATAAAGGAAGAGAGGCAGG + Intronic
1148897618 17:50848886-50848908 CAGGAGGAAGAGAGAGAGGGGGG + Intergenic
1149344679 17:55722876-55722898 GGGAATAAAAAGAGAGAGGGAGG - Intronic
1149358453 17:55868748-55868770 CAGAAGAAAGAGAGAGAGTAGGG + Intergenic
1149406546 17:56357507-56357529 CAGTAGAAAGGGAGAGATGCAGG - Intronic
1149417580 17:56476029-56476051 CGGGAGAAAGAGAGTGAGGCAGG + Intronic
1149465964 17:56879331-56879353 AAGAAAAAAGAGAGTGAGGCTGG + Intergenic
1149471205 17:56916558-56916580 CACCAAAAAGAGAGAGAGGAAGG + Intergenic
1149493607 17:57102623-57102645 AAAAAAAAAGAGAGAGAGCCGGG - Intronic
1149559318 17:57596827-57596849 AAGAAAAAACAAAGAGAGGCGGG - Intronic
1149793245 17:59497435-59497457 AAAAAAAAAGAGAGAGAGACTGG - Intergenic
1150054078 17:61995165-61995187 CAAAATAGTGAGAGAGAAGCTGG - Exonic
1150365154 17:64576204-64576226 CAAAAAAAAGAGAGGGAGGGAGG + Intronic
1150498764 17:65630078-65630100 CAGATTAAAGAAAGGTAGGCCGG + Intronic
1150545653 17:66154990-66155012 GAGAAGAGAGAGAGAGAGGGAGG - Intronic
1150645751 17:66976529-66976551 AAGAATAAAGAGAGGAAGGAGGG - Intronic
1150944246 17:69727199-69727221 AAGAAGAAAGAGAGAGAGAAGGG + Intergenic
1151169907 17:72237305-72237327 CAGAATCAAAAGAGAGAAGGAGG + Intergenic
1151395844 17:73822391-73822413 TAGAATGAAGAAAGTGAGGCAGG + Intergenic
1151648136 17:75447799-75447821 AAGAAGAGAGAGAGAGAGACAGG - Intronic
1152153062 17:78615074-78615096 CAGGAGAAAGAGAGAGACGAGGG - Intergenic
1152213364 17:79017069-79017091 CAGGAGAAAGAGAGAGAGCGAGG + Intergenic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152385041 17:79968555-79968577 CACTATCAAGAGAGTGAGGCCGG + Intronic
1153139104 18:1952220-1952242 CAGATAAAAGAGAGAGAGGGAGG - Intergenic
1153224023 18:2884250-2884272 CAAAAAAAAGAAAAAGAGGCTGG - Intronic
1153371987 18:4328223-4328245 CAGCTTAAAGAGAGAGAGCGAGG - Intronic
1153659753 18:7316406-7316428 GAGAAGAAAGTTAGAGAGGCTGG + Intergenic
1153862161 18:9223246-9223268 AAAAAAAAAGAGAGAGAGGTGGG - Intronic
1153877007 18:9382847-9382869 AAGAATAAATTAAGAGAGGCTGG + Intronic
1154002863 18:10498708-10498730 CAAAAGAAAGATGGAGAGGCAGG + Intergenic
1154208715 18:12360614-12360636 GAGAATAAAGAGGGAGTGCCTGG - Intronic
1154264184 18:12865444-12865466 AAAAAAAAAAAGAGAGAGGCGGG + Intronic
1154283703 18:13031971-13031993 CAGGATAAAGGGAGAGTGGCCGG + Intronic
1154466961 18:14655262-14655284 AAAAAAAAAGAGAGAGAGACTGG - Intergenic
1155058258 18:22204430-22204452 AAGAAGAAAGAAAGAGAGGGGGG - Intergenic
1155256588 18:24003124-24003146 TAGAGTATAGAGAGTGAGGCAGG - Intronic
1155428824 18:25734289-25734311 CAGGAGAAAGAGAGAGAGAGTGG - Intergenic
1155451043 18:25963077-25963099 CAGATGAACAAGAGAGAGGCAGG - Intergenic
1155688102 18:28580566-28580588 CAGGAGCAAGAGAGAGAGGTGGG + Intergenic
1156131752 18:33984590-33984612 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
1156179411 18:34585599-34585621 AAGAAGAAAGAGAGAGAGATAGG + Intronic
1156314723 18:35957926-35957948 CGGAAGAAAGAGAGAGAGGGAGG + Intergenic
1156453065 18:37277456-37277478 GAGAAGGAAGAGAGAGAGGGAGG + Intronic
1156686803 18:39659325-39659347 AAAAATACAAAGAGAGAGGCGGG + Intergenic
1156812666 18:41271789-41271811 CAGAAGCAAGAGAGGGAGGTGGG - Intergenic
1156819841 18:41359095-41359117 CAGAAGCAAGAGAGAGAGTGGGG - Intergenic
1156886932 18:42145769-42145791 CAGGAGAAAGAGAGAGAGGGTGG + Intergenic
1157334135 18:46724974-46724996 AGGAAGAAAGAGAGAGAGGAAGG + Intronic
1157697171 18:49732170-49732192 CTGAATGATGAGAGTGAGGCTGG + Intergenic
1158076524 18:53536501-53536523 AAAAAAAAAGAGAGAGAAGCAGG + Intergenic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158344883 18:56506281-56506303 CTGAAGTGAGAGAGAGAGGCTGG + Intergenic
1158462202 18:57656282-57656304 CAGAATATCAAGAGAGAGACTGG - Intronic
1158504256 18:58032121-58032143 AAAAAAAAAGAGAGAGAGACAGG - Intergenic
1158757324 18:60341626-60341648 CTGAGGAAAGGGAGAGAGGCTGG - Intergenic
1159031795 18:63239221-63239243 GAGTATAAAGAAAGGGAGGCTGG + Intronic
1159089213 18:63828262-63828284 CAGAAGCAAGAGAGAGAGATGGG - Intergenic
1159114881 18:64102756-64102778 CAGGAGAAAGAGAGAGAGTGGGG + Intergenic
1159236796 18:65685295-65685317 CAAAAAAGAGAGAGAGAGGAAGG + Intergenic
1159599088 18:70411556-70411578 AAGAAGAAAGAGAAAGATGCTGG - Intergenic
1159837956 18:73363433-73363455 GAGAAAAAAGAGAGAGAAGGAGG + Intergenic
1160041259 18:75347746-75347768 AAGAATGAAGAGAGGGAGGGAGG + Intergenic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1161074793 19:2280368-2280390 CATTAAAAAGAGAGAGAGGCTGG - Intronic
1161256844 19:3314505-3314527 AAGAGAGAAGAGAGAGAGGCAGG - Intergenic
1161341879 19:3747529-3747551 CATAAAAAAGAGAGAGAGAATGG + Intronic
1161397066 19:4050355-4050377 CAGAAACAAGAGAGACCGGCCGG - Intronic
1161417438 19:4155341-4155363 AAGAAGAAAGAGAGAAAGGAAGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161649923 19:5478140-5478162 AGAAAGAAAGAGAGAGAGGCTGG + Intergenic
1161662794 19:5557640-5557662 GAGAACAGAGAGATAGAGGCAGG + Intergenic
1162416093 19:10538521-10538543 AAAAAAAAAGAGAGAGAGACGGG - Intergenic
1162420604 19:10564158-10564180 AAGAAAAAAGAAAGAAAGGCTGG + Intronic
1162483535 19:10944129-10944151 AAAAAAAAAGAGGGAGAGGCTGG + Intergenic
1162660894 19:12168391-12168413 CACAGTAAAGGGGGAGAGGCTGG + Intronic
1162841770 19:13362010-13362032 AAAAAAAAAGAGAGAGAGGAAGG - Intronic
1162972920 19:14191992-14192014 CCCAATAAGAAGAGAGAGGCCGG - Intronic
1163345115 19:16736228-16736250 CAAAAGAAAGAGAGAGAGGAAGG - Intronic
1163579408 19:18129342-18129364 CACCATCAAGAGGGAGAGGCCGG + Intronic
1163736246 19:18982822-18982844 CAAGAAATAGAGAGAGAGGCTGG + Intergenic
1163755839 19:19105771-19105793 CAGAAGAAAGAGAGAGGGGCGGG - Intronic
1163998570 19:21076136-21076158 AAGAAAAAAGAAAAAGAGGCCGG - Intergenic
1164217815 19:23165435-23165457 AAAAAAAAAGAGAGAGAGGCTGG - Intergenic
1164691127 19:30211495-30211517 CAGAATAGAGAGAGAGTGAAGGG + Intergenic
1165388219 19:35524187-35524209 TAAAATAAAGAAAGAGAGTCAGG + Intronic
1165786970 19:38467428-38467450 CAGAAAAGTCAGAGAGAGGCAGG - Intronic
1165873513 19:38989648-38989670 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1165884588 19:39068844-39068866 CAAAAAAAAGAAACAGAGGCTGG - Intergenic
1166241886 19:41500080-41500102 AAGAATCCAGAAAGAGAGGCGGG + Intergenic
1166398086 19:42457185-42457207 CAGATTAAAAAAACAGAGGCAGG - Intergenic
1166734222 19:45075258-45075280 CAGAATTGACAGAGAGAGACAGG + Intronic
1166898777 19:46041824-46041846 AAAAAAAAAGAGAGAGAGGAGGG - Intronic
1166929517 19:46293542-46293564 AAAAATTAAGAGATAGAGGCCGG + Intergenic
1166929573 19:46293870-46293892 AAAAAAAAAGAGATAGAGGCCGG + Intergenic
1167192484 19:48001160-48001182 AAAAAAACAGAGAGAGAGGCAGG - Intronic
1167290611 19:48623250-48623272 AAAAAAAAAGAGAGAGAGACGGG + Intronic
1167304419 19:48698908-48698930 CAGAAGACACAGAGAGAGGCAGG - Intronic
1167389506 19:49185012-49185034 AAGAATACAGAGATAGAGGCAGG - Intronic
1167487572 19:49772056-49772078 CAAAAAAAAGAAAGAGAGACAGG - Intronic
1167492968 19:49802434-49802456 CAGAAGAGAGACAGAGAGGGAGG - Intronic
1167749428 19:51370935-51370957 GAAAATGAAGAGGGAGAGGCAGG - Intergenic
1168149554 19:54437688-54437710 GACAAAAAACAGAGAGAGGCTGG + Intergenic
1168264423 19:55214355-55214377 CAGGAGCAAGAGAGAGAGGACGG + Intergenic
1168323898 19:55528245-55528267 CAGAAAAGAGACAGAGAGGAAGG - Intergenic
1168327431 19:55545440-55545462 GAAAAGAAGGAGAGAGAGGCAGG - Intronic
1168357776 19:55713069-55713091 CAGAGAAAAGAGAGCCAGGCAGG - Intronic
1168402932 19:56096421-56096443 AAAAATAAAAAGAGATAGGCTGG + Intronic
1168690025 19:58370913-58370935 AAGAAAAGAGAGAGAGAGGGAGG + Intronic
925035817 2:684862-684884 CAGGAGAAAGAGAGAGAGTGAGG - Intergenic
925427459 2:3762572-3762594 CAGGAGCAAGAGAGAGAGTCGGG + Intronic
925600000 2:5598555-5598577 CTAAATAAGGAGAGAGAGGTGGG + Intergenic
925931495 2:8711851-8711873 TGGAATGAAGAGGGAGAGGCTGG + Intergenic
925933701 2:8732883-8732905 CAGAGCAAAGTGAGAGATGCAGG - Intronic
926042747 2:9687807-9687829 AAGTATAAAGATAGAGAGCCAGG + Intergenic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926128543 2:10286324-10286346 CTGAATAGAGAGGCAGAGGCAGG + Intergenic
926376683 2:12236151-12236173 GAGAATAAGGAGAGAGAGAGAGG - Intergenic
926394965 2:12431450-12431472 CAGCATAATGAGAGAGATGGTGG + Intergenic
926550781 2:14298645-14298667 CACAAGGAAGAGACAGAGGCTGG - Intergenic
927311755 2:21639451-21639473 CAGAAGCAAGAGAGAGAGGCGGG + Intergenic
927350156 2:22102032-22102054 CAGAAAAAAGAAAGCTAGGCAGG + Intergenic
927542921 2:23928188-23928210 AAGAAGAAAGAGAGAGAGAAAGG + Intronic
927543038 2:23929126-23929148 AAAAAGAAAGAGAGAGAGACAGG + Intronic
927737035 2:25533622-25533644 AAGTAGAAAGAGAGAGAGGCAGG - Intronic
928051531 2:28001739-28001761 CAGGAGCAAGAGAGAGAGGAGGG + Intronic
928290321 2:30031014-30031036 CAGAATACAGAGAGAAGTGCAGG - Intergenic
929399466 2:41563282-41563304 CAGAGTAAAGGGAGAGAGGATGG - Intergenic
930068723 2:47348090-47348112 AAAAAAAAAGAGAGAGAGTCCGG + Intronic
930082313 2:47461885-47461907 AAGAAAAGAGAGACAGAGGCTGG - Intronic
930296048 2:49555299-49555321 CAGAATAAAGAGTAAGTGGCAGG - Intergenic
930348955 2:50224666-50224688 AAGATTAAAGAGAGAGAGAGAGG + Intronic
930371466 2:50506740-50506762 AGGAAGAAAGAGAGAGAGGAGGG + Intronic
931085854 2:58830282-58830304 CAGAAAAGAGAGAGAGAGAGTGG - Intergenic
931152309 2:59587977-59587999 AAGAAAAATGAGAGAGAGGAAGG + Intergenic
931682550 2:64763720-64763742 CAGGATACAGAGACTGAGGCTGG - Intergenic
931903274 2:66815081-66815103 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
932061005 2:68497441-68497463 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
932080919 2:68714469-68714491 CAGAAGAAAGAGATAGATACAGG - Intronic
932336077 2:70932132-70932154 GAGAACAAAGGGAGAGAGGAGGG + Intronic
932615907 2:73231413-73231435 CAAAAAAAAGAAAAAGAGGCCGG - Intronic
932724589 2:74168275-74168297 CAGAATAAAATGGAAGAGGCAGG + Intronic
933098656 2:78222624-78222646 AACACTAAAGAGTGAGAGGCGGG + Intergenic
933478348 2:82820807-82820829 AAGAAGAAAGAGAGAGAGAGAGG - Intergenic
933482128 2:82870717-82870739 CAGAACCCAGAGAGAGAGGTGGG + Intergenic
933583588 2:84155032-84155054 CAGAAGCAAGAGAGAGAGAATGG - Intergenic
933635238 2:84701641-84701663 CAGGAGCAAGAGAGAGAGGGGGG + Intronic
933664017 2:84950157-84950179 AAGAAAAGAAAGAGAGAGGCCGG + Intergenic
933881419 2:86673681-86673703 CAGAAGAAAGAGTGAGAGATAGG + Intronic
934184287 2:89657913-89657935 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
934741944 2:96730669-96730691 CAAAAAAAAGAGAGAGAGAGGGG - Intronic
934754026 2:96812833-96812855 CAAGATAAAGAGACAGATGCTGG - Intergenic
935164465 2:100558096-100558118 CAGAAGAAAGAGAGAGAGGACGG + Intergenic
935491366 2:103724500-103724522 CAGGAGGAAGAGAGAGAGGGGGG - Intergenic
935675153 2:105588872-105588894 CAGAATTCAGTGAGAGTGGCAGG - Intergenic
935699928 2:105802568-105802590 CGGAAGCAAGAGAGAGAGGAGGG + Intronic
935731388 2:106066967-106066989 AAGAACAAAGAGTGGGAGGCAGG - Intronic
935874791 2:107494749-107494771 CAGAGGAAAGAAAGAGAGGAAGG + Intergenic
936629504 2:114186519-114186541 CAGGAAAAGGAGAGAGAAGCAGG - Intergenic
936634144 2:114236144-114236166 CCCAAGAAAGAGAGAGAGGAAGG + Intergenic
936726557 2:115324918-115324940 CTGAAGAGAGAGAGAGAGACAGG + Intronic
936728481 2:115352854-115352876 CATAGTAAAGAGAGAGATGTAGG - Intronic
936991774 2:118374325-118374347 CTGAGTAAAGAAGGAGAGGCAGG - Intergenic
937447035 2:121967129-121967151 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
937485239 2:122308704-122308726 GAGAATACAGAGAGAAAGGCAGG + Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937800970 2:126079841-126079863 CAGAAAAAACAGAGAGAAGGAGG + Intergenic
937979276 2:127604750-127604772 CAGAGAAAAGAGAGAGAGATGGG + Intronic
938321130 2:130364962-130364984 CAGCAGAGAGAGAGAGAGGGAGG + Intronic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
939357273 2:141119452-141119474 CATACTAAAGTGAGAGAGGGAGG + Intronic
939428626 2:142073822-142073844 CAGGAGGAAGAGAGAGAGGAAGG - Intronic
939444612 2:142292406-142292428 AAGGAAAAAGAGAGAGAGGGGGG - Intergenic
939480855 2:142745330-142745352 CAGGATAATGTGACAGAGGCTGG - Intergenic
939622917 2:144442188-144442210 CATAATAAATTGAGAAAGGCAGG - Intronic
939784107 2:146487453-146487475 AAGGAAAAAGGGAGAGAGGCAGG + Intergenic
939978423 2:148748177-148748199 CAGAAGAAAGAGAGAGAAGGGGG - Intronic
939980658 2:148776843-148776865 AAAAAAAAAGAGAGAGAGACAGG - Intronic
940148872 2:150577621-150577643 CAGCAGGAAGAGAGAGAGGAGGG + Intergenic
940196013 2:151094845-151094867 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
940199268 2:151132136-151132158 AAAAAAAGAGAGAGAGAGGCTGG + Intergenic
940529651 2:154864923-154864945 TAGAATAAAGACAAAGAGGGAGG - Intergenic
941247367 2:163116198-163116220 CAGAAGGAAGAGAGAGAGGGTGG - Intergenic
941255424 2:163224501-163224523 AAAAAAAAAGAGAGAGAGACAGG + Intergenic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
941315336 2:163985102-163985124 CACATTAAAGAAAGAAAGGCAGG - Intergenic
941401041 2:165031491-165031513 AAGAAAAAAGAGAGAGAGAGAGG - Intergenic
941751325 2:169137847-169137869 AAGAATAAGGAGAGAGGGGAAGG + Intronic
942398291 2:175575294-175575316 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
942572635 2:177329318-177329340 CAGAAGGAAGAGAGAGAGTGGGG - Intronic
942955020 2:181763778-181763800 CAGAAGATTGAGAGAGAGGTGGG + Intergenic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943677539 2:190730934-190730956 CAGGAGGAAGAGAGAGAGGGGGG - Intergenic
943983745 2:194592090-194592112 CATAGTAGAGAGAGAGAGACAGG + Intergenic
944008125 2:194936876-194936898 CAGGAGAGAGAGAGAGAGGGAGG + Intergenic
944313184 2:198258199-198258221 GAGAATCAAGAGACAGAAGCTGG + Intronic
944489018 2:200238323-200238345 GAGAAGGAAGAGAGAGAAGCTGG + Intergenic
944601304 2:201306228-201306250 CAAAAGAAAGAGAGAGAAGGGGG + Intronic
944822449 2:203444135-203444157 AAAAAAAGAGAGAGAGAGGCTGG + Exonic
945013102 2:205485813-205485835 AAGGATAAAGAGAGGGTGGCTGG - Intronic
945050530 2:205819983-205820005 CAGAGAGAAGAGAGAGAGGAGGG - Intergenic
945101892 2:206269904-206269926 AAGAAAAAAGAGAGAGAGAAAGG - Intergenic
945123652 2:206485268-206485290 TAGAATAAAGGTAGAGAGTCAGG + Intronic
945204333 2:207315738-207315760 AAAAAAAAAGAGAGAGAGGGTGG + Intergenic
945300680 2:208213373-208213395 CAGAAATAAATGAGAGAGGCCGG + Intergenic
946094180 2:217258257-217258279 TAGAATAAAGATAAAGGGGCTGG + Intergenic
946770591 2:223084875-223084897 CTGAATAATGAGAGAGAGCCAGG - Intronic
946805190 2:223464320-223464342 CAGAAGGAAGAGAGAGAGGGTGG - Intergenic
946911365 2:224464503-224464525 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947228313 2:227860779-227860801 AAGAAAAAAGACAGAAAGGCAGG + Intergenic
947626654 2:231623393-231623415 CTCAAAAAAGAAAGAGAGGCCGG + Intergenic
947646642 2:231746845-231746867 CAGAACCAAGAGACAGAGCCAGG + Intronic
947679749 2:232019544-232019566 AAAAAAAAAGAGAGAGAGACAGG - Intronic
947747616 2:232517085-232517107 GAGAAGAAAGAGGGAGAGCCTGG + Intergenic
947948721 2:234129192-234129214 AGGAAGAAAGAGAGAGAGGGAGG - Intergenic
948057488 2:235019363-235019385 CAGAAGAAAGGGAGAGATGCAGG + Intronic
948282958 2:236762577-236762599 CAGGATCCAGAGAGAGAGGCCGG + Intergenic
948288239 2:236803852-236803874 CAGAGGTCAGAGAGAGAGGCAGG + Intergenic
948658728 2:239493347-239493369 CAGAAGGAAGAGAGAGAAGGAGG + Intergenic
1168814141 20:725179-725201 CAGACAGAAGAGAGAGAGGCTGG - Intergenic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1169259348 20:4124507-4124529 AAGAAAAAAGAGAGGGGGGCGGG - Intronic
1169265746 20:4166511-4166533 CAGAAAGAAGCCAGAGAGGCTGG - Intronic
1169289403 20:4335800-4335822 CAGGAAAAAGAGAGAGAGACGGG - Intergenic
1169541650 20:6606333-6606355 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1169672729 20:8121306-8121328 CAGGAGAAAGAGGGAGAGGATGG + Intergenic
1169709794 20:8548516-8548538 GAAAAGAAAGAGAGAGAGGGAGG - Intronic
1170101498 20:12705408-12705430 AAGAAAAAAAAGAGAGAGGAAGG - Intergenic
1170337814 20:15290330-15290352 CAGAATATAGAAAGTGAGGCTGG - Intronic
1170466296 20:16625472-16625494 CAGAAAAAAGAAAGACAGGGAGG - Intergenic
1171089604 20:22271498-22271520 CAGACTAAAGAGAGAGAGAGAGG + Intergenic
1171251821 20:23654629-23654651 GGGAATAAAGAGGTAGAGGCAGG + Intergenic
1171282501 20:23912464-23912486 CTGAATAAACAGAGAGACCCTGG - Intergenic
1171478616 20:25434743-25434765 CAGAATTAATTGAGACAGGCTGG - Intronic
1171907738 20:30913903-30913925 CAGAAGACACAGAGAGAGACAGG - Intergenic
1172007462 20:31827116-31827138 CACAGCAAAGAGAGAGAGGGGGG + Intronic
1172228713 20:33322750-33322772 AGAAATAAAGAGACAGAGGCAGG + Intergenic
1172288501 20:33758211-33758233 GAGAATAACTAGGGAGAGGCTGG + Intronic
1172545099 20:35754565-35754587 TAGAATCAAGAGCGAGATGCTGG + Intergenic
1172606036 20:36214700-36214722 CAGCAGAGAGAGAGAGAGGATGG + Intronic
1173029137 20:39338531-39338553 AAGAAGAAAGACACAGAGGCTGG + Intergenic
1173051610 20:39567736-39567758 CAGAAAAAAGAGAGAGAGGGGGG - Intergenic
1173343624 20:42177869-42177891 AAGAAAAAAGAGAGAGAGGAAGG - Intronic
1173578066 20:44126125-44126147 CAGAAGAAAAAGAGAGAGGGAGG + Intronic
1173843079 20:46171614-46171636 AAGAAAGAAGAGAGAGAGGGAGG + Intergenic
1173921709 20:46751052-46751074 CAGGAGGAAGAGAGAGAGGTGGG + Intergenic
1174199266 20:48795600-48795622 CAGAAGAAAAAGAAAAAGGCAGG + Intronic
1174217832 20:48930812-48930834 CGGTATACAGAGGGAGAGGCAGG + Intronic
1174301553 20:49585906-49585928 CAGAATCCAGAGAAAGAGGAAGG + Intergenic
1174310318 20:49648256-49648278 AAGAAAGAAGAGAAAGAGGCTGG + Intronic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175142766 20:56873160-56873182 AAAAAGAAAGAGAGAGAGGGAGG + Intergenic
1175704994 20:61170179-61170201 CAGACTCAAGAGGGAGAAGCTGG + Intergenic
1176162831 20:63657205-63657227 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
1177126319 21:17197850-17197872 AAGAAGAAAGAGAGAGAGAGAGG + Intergenic
1177200880 21:17954519-17954541 TAGAACAAAGAGACAGAGGAAGG + Intronic
1177342170 21:19817528-19817550 AAGAATAATGAGAGAGAAACAGG + Intergenic
1177385361 21:20403240-20403262 AAGAATAAAGAAAGAGTGGAGGG + Intergenic
1177423658 21:20895030-20895052 CAGGATAAAGACAGAGAGAAAGG - Intergenic
1177515541 21:22147128-22147150 CAGGAGAAAGAGAGAGAAGGTGG - Intergenic
1177534762 21:22409829-22409851 AATAAAAAAGAGAGAGAGGAAGG - Intergenic
1177542689 21:22516270-22516292 CAGAGGAAAGAGTTAGAGGCTGG + Intergenic
1177552039 21:22635597-22635619 TAGAAAGAAGAGAGGGAGGCCGG - Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1177767611 21:25476056-25476078 TAGAAGGAAGAGAGAGAGGTGGG - Intergenic
1177770850 21:25513935-25513957 CAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1177774396 21:25551747-25551769 CAGAAGCAAGAGAGTGAGGTGGG + Intergenic
1177936056 21:27347974-27347996 AGAAAGAAAGAGAGAGAGGCCGG + Intergenic
1177963259 21:27695405-27695427 AAGAAAAAAAAGAGAGAGGAAGG - Intergenic
1178096395 21:29220147-29220169 CAGCATAAAGACAGAGAGAGAGG - Intronic
1178140248 21:29674653-29674675 CAGAAGAGAGAGAGAGAGCAAGG - Intronic
1178195903 21:30344786-30344808 CTGAAGAAAGGGAGAGAGACAGG - Intergenic
1178297537 21:31422972-31422994 CAGTAAAGAGAGAGAGAGACTGG - Intronic
1178977387 21:37231613-37231635 CAGAATAAAGAATTAGAGGAAGG + Intronic
1179055876 21:37933602-37933624 CAGGAGAAAGAGAGAGAGTAAGG - Intergenic
1179116694 21:38499806-38499828 CAGAAGAGAGAGAGAAAGGAAGG + Intronic
1179432496 21:41333457-41333479 CAGAAACAAGAGAGAGAAGAGGG - Intronic
1179893076 21:44347101-44347123 CAGGAGTAAGAGAGAGAGACAGG + Intergenic
1180186923 21:46144731-46144753 CAGAAAAGAGAGAGAGAGGGAGG - Intronic
1180817370 22:18799495-18799517 CAGGAGCAAGAGAGAGAGGGGGG - Intergenic
1181203560 22:21233816-21233838 CAGGAGCAAGAGAGAGAGGGGGG - Intergenic
1181291402 22:21796652-21796674 AAGAAGAAAGAGAGAGAGAAAGG + Intronic
1181301067 22:21881573-21881595 CAAAAGAGAGAGAGAGAGGGAGG + Intergenic
1181332065 22:22100494-22100516 CAGAAGAAAGAGTCAGAGGAAGG - Intergenic
1181347079 22:22227443-22227465 AAAAAAAAAGAGAGAGAGGCTGG - Intergenic
1181506619 22:23362736-23362758 CAGGAGGAAGAGAGAGAGGGAGG - Intergenic
1181649478 22:24250879-24250901 AAAAAAAAAGAGAGAGAGTCTGG + Intergenic
1181890482 22:26058700-26058722 AGGAAGAAAGAGAGAGAGGCAGG - Intergenic
1181914844 22:26271628-26271650 CAGAAACAAGAGAGAGAAGGGGG - Intronic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182541276 22:31043909-31043931 CCGAAAAAAGAAAAAGAGGCTGG + Intergenic
1182962169 22:34485487-34485509 CAGAAGGAAGAGAGAGAAGCGGG + Intergenic
1183020077 22:35019851-35019873 AAGAATAAAGACATGGAGGCTGG - Intergenic
1183068111 22:35377635-35377657 CAGAGGACAGAGAGAGAGACTGG - Intergenic
1183155226 22:36069716-36069738 CAGAATAGAGAGAGAGGGTGAGG + Intergenic
1183594629 22:38803196-38803218 AAAAAGAAAGAGAGAGAGGAAGG - Intergenic
1184144794 22:42603363-42603385 CAAAATTAAGAGAGAGGGGCTGG + Intronic
1184216028 22:43067798-43067820 AAAAAGAAAGAGAGAGAGGTGGG - Intronic
1184268834 22:43365937-43365959 CAGACCATGGAGAGAGAGGCTGG + Intergenic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184709670 22:46241538-46241560 CAGAACAGAAAGAGACAGGCTGG + Exonic
1184956400 22:47889712-47889734 CAGGAGAAAGAGAGAGGGGGAGG - Intergenic
1185006033 22:48277460-48277482 CAGAAGAAGGTGGGAGAGGCTGG + Intergenic
1203223361 22_KI270731v1_random:61598-61620 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
1203267468 22_KI270734v1_random:25222-25244 CAGGAGCAAGAGAGAGAGGGGGG - Intergenic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949540847 3:5031025-5031047 GAAAAGAAAGAGAGAGAGGGAGG + Intergenic
949540854 3:5031059-5031081 GAAAAGAAAGAGAGAGAGGGAGG + Intergenic
949962076 3:9320486-9320508 CAGGAGCAAGAGAGAGAGGTGGG - Intronic
950038687 3:9905517-9905539 GAAAGAAAAGAGAGAGAGGCAGG + Intronic
950058727 3:10051082-10051104 CAAAAAAAAAAGAGTGAGGCCGG + Intronic
950403923 3:12792763-12792785 AAGAAAAAAGAAAAAGAGGCTGG - Intergenic
950665026 3:14490120-14490142 CAGTACACATAGAGAGAGGCAGG - Exonic
950721848 3:14888790-14888812 CAGAACAAAGACACAGAGGCTGG + Intronic
951221231 3:20070598-20070620 CAGTATAAGAAAAGAGAGGCCGG - Intronic
951398863 3:22204910-22204932 GAGGATAGAGAGAGAGAGCCTGG + Intronic
951519330 3:23596806-23596828 AAGAATAAAGAGGGAGAGGAGGG - Intergenic
951880715 3:27478842-27478864 AAAAAAAAAGAGAGAGAGGGGGG + Intronic
951882830 3:27496227-27496249 CAGAATAAAGAGGGAGCCGTAGG + Intergenic
951894784 3:27600437-27600459 CAGGTAAAAGAAAGAGAGGCTGG - Intergenic
952296362 3:32066118-32066140 CTGAAGAAAGAGAGAGAGAAAGG + Intronic
952480486 3:33755871-33755893 AAGAATAAATTGATAGAGGCTGG + Intergenic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
953175416 3:40547241-40547263 AAGAAGAAAGAGAGAGAGGGAGG - Intronic
953762511 3:45700966-45700988 CATTAAAAAGAGATAGAGGCTGG - Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954514813 3:51164324-51164346 CAAAATAAAGAGATTCAGGCCGG + Intronic
954732282 3:52674491-52674513 AAAAAAAGAGAGAGAGAGGCTGG + Intronic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
954933099 3:54301300-54301322 CAGAAAAAAAAAAAAGAGGCCGG + Intronic
954984547 3:54778137-54778159 CAGAAGGAAGAGAGAGAGTGGGG + Intronic
955063053 3:55510681-55510703 CAGATTAAAGAAATAGAGGAGGG + Exonic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955105838 3:55897191-55897213 CAGATAACTGAGAGAGAGGCTGG - Intronic
955293074 3:57710915-57710937 CAAAAGAAAGAGAGAGAGAAAGG + Intergenic
955480891 3:59388670-59388692 CAGAATAAAGAGGAAGTGACAGG - Intergenic
955661045 3:61299458-61299480 AAGAAGAGAAAGAGAGAGGCTGG - Intergenic
955885459 3:63593461-63593483 TGAAATAAAGAGAGAGATGCAGG + Intronic
955954029 3:64269855-64269877 CACAATAAAGAAAGGAAGGCTGG + Intronic
955974014 3:64463592-64463614 CAGAGTAATGATTGAGAGGCTGG + Intergenic
956152552 3:66258809-66258831 AAGAAAAAAGAGAGAGATGAGGG - Intronic
956726847 3:72163421-72163443 AAGAAGAAAGAAAGAAAGGCAGG + Intergenic
956765346 3:72480122-72480144 CAGGAGAAAGAGAGAGAGGGGGG - Intergenic
956775098 3:72558446-72558468 CAGGAGCAAGAGAGAGAGGCAGG - Intergenic
957047332 3:75386151-75386173 AAGAATAAAGAAAGAGAGACAGG + Intergenic
957174344 3:76786468-76786490 CAGAAAGAAGAGAGAGAAGGGGG + Intronic
957320659 3:78625960-78625982 CTGAATGAAGAGGAAGAGGCTGG + Intronic
957953842 3:87158796-87158818 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
957960328 3:87241464-87241486 CAGGAAAAAGGGAGACAGGCAGG - Intronic
958133008 3:89453945-89453967 CAGAAGAGAGAGAGGGAGACAGG - Intronic
958175613 3:89992052-89992074 CAGAAGGAAGAGAGAGAGAAAGG - Intergenic
958444200 3:94194835-94194857 CAGAAGCAAGAGAGAGAGTGGGG - Intergenic
958780195 3:98531916-98531938 GAAAAAAGAGAGAGAGAGGCAGG + Exonic
959021760 3:101195231-101195253 CAGAAGAAAGAGAGTGAAGCGGG + Intergenic
959138112 3:102450506-102450528 TAGAAGAGAGAGAGAGAGGGAGG + Intronic
959202056 3:103259689-103259711 CAGAAGCAAGAGAGAGAGTGAGG + Intergenic
959686960 3:109158003-109158025 CAGAAGACAGAGAGTGAGGGGGG + Intergenic
960045979 3:113199005-113199027 CAGAAAAGAGAGAGAAAGGGAGG - Intergenic
960114158 3:113876819-113876841 AAGAATAAAGAAGGAGAGGAAGG + Intronic
960135213 3:114097769-114097791 GAAAAGAAAGAGAGAGAGGAAGG - Intergenic
960724878 3:120660063-120660085 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
960822203 3:121746774-121746796 AAGAATAAAGTGAGTTAGGCCGG - Intronic
960959734 3:123061819-123061841 CAGGAGGAAGAGAGAGAGGGGGG + Intergenic
961004624 3:123396681-123396703 CAAAAGAAAGAGAGAGAGAGAGG + Intronic
961680920 3:128599519-128599541 CAGAATAAATAGATACAGGCCGG + Intergenic
962094767 3:132282024-132282046 CAGAAAAAAAACAGAGAGACAGG + Intronic
962136308 3:132737932-132737954 CAGAAGGAAGAGAGAGAGCGGGG + Intergenic
962261186 3:133908513-133908535 CAGAAGAAAGATGGAGATGCAGG - Intergenic
962565172 3:136650242-136650264 AAAAAAAAAGAGAGAGAGACAGG + Intronic
962655078 3:137535505-137535527 CAGAATTAAGAGAGAGAGTGTGG - Intergenic
962834221 3:139172601-139172623 CAAAAAAAAAAGAAAGAGGCCGG - Intronic
962932862 3:140053655-140053677 CAGAAATAAGAGAGAGAGGAGGG - Intronic
963200724 3:142583353-142583375 CAGAATAAAAGGAGAGTAGCAGG + Intergenic
963297551 3:143562389-143562411 AAGAGCAAAGGGAGAGAGGCAGG + Intronic
963343040 3:144060648-144060670 CAGAAACAATGGAGAGAGGCAGG + Intergenic
963455694 3:145543827-145543849 CAGGAGAAAGAAAGAGAGGTGGG - Intergenic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
963538488 3:146557909-146557931 AAGAAGCAAGAGAGAGAGGAGGG - Intergenic
963543130 3:146620280-146620302 CAGATAAAAGAAAGAGAGGAAGG - Intergenic
963600478 3:147374074-147374096 GAGAATTAAGAGAGAGATGGTGG - Intergenic
963613120 3:147497488-147497510 CAGAACAATAAGAGAAAGGCAGG + Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963707870 3:148710897-148710919 CAGGAGCAAGAGAGAGAGGGGGG - Intronic
963774878 3:149428611-149428633 CAGGAGAAAGAGAGTGAGGGAGG + Intergenic
964108105 3:153060453-153060475 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
964120700 3:153180310-153180332 GAGAATAAAGGGAGGGAGGGAGG - Intergenic
964158863 3:153621547-153621569 AAGAAGAGAGAGAGAGAGGTGGG + Intergenic
964276100 3:155010576-155010598 CAGAAGGAAGAAGGAGAGGCTGG - Intergenic
964298708 3:155263043-155263065 CAGGAGGAAGAGAGAGAGACAGG - Intergenic
964419275 3:156484362-156484384 AAGAAAAAAGAGAGAGAGAGAGG + Intronic
964718356 3:159746695-159746717 CAGGATATAGGGAAAGAGGCTGG - Intronic
964746799 3:160020195-160020217 GAGAAGAAAGAGAGAAAGGAAGG + Intronic
964910228 3:161772118-161772140 CCCAAGAAAGAGAGAGAGCCAGG - Intergenic
964964950 3:162481272-162481294 CAGAATAGAGAGAGAGAGAGAGG - Intergenic
965019086 3:163203095-163203117 CTGAATAAAGTGAAAGAGACTGG + Intergenic
965090197 3:164151609-164151631 CACATTACAGAGAGAGAGGAAGG - Intergenic
965440162 3:168702638-168702660 CAGAAGAAATAGAGAGATGTGGG - Intergenic
965619195 3:170625543-170625565 CAGAAGAAAGAGAGAGAAGGGGG - Intronic
965851407 3:173030113-173030135 CAGAATATAGATAGACAGGTAGG - Intronic
965864892 3:173194501-173194523 TAAAAGAAAGAGAGAGAGGAGGG + Intergenic
965898449 3:173608734-173608756 AGGAAAAAAGAGAGAGAGGAAGG - Intronic
965993965 3:174856010-174856032 GAGAAGTAAGAGAGAGAGACAGG + Intronic
966017468 3:175159816-175159838 AAGAAAAGAGAGAGAGAGGAAGG - Intronic
966289640 3:178341060-178341082 GAGAATAAAAACAGAGAGACAGG - Intergenic
966400495 3:179542508-179542530 GAAAAGAAAGAGAGAGAGGAAGG + Intergenic
966423431 3:179756445-179756467 CAAAAAATACAGAGAGAGGCTGG + Intronic
966592348 3:181696532-181696554 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
967068899 3:185944947-185944969 AAAAAAAAAGAGAGAGAGGCCGG + Intergenic
967073848 3:185984471-185984493 GAAAAAAAAGAGAGAGAGGGAGG - Intergenic
967260520 3:187637252-187637274 GAGTATTAAGAGAGAGAGTCAGG - Intergenic
967375232 3:188793476-188793498 CAGTATAATGAGAAAGTGGCCGG - Intronic
967380781 3:188855454-188855476 CAGGATAAAGAGACAGAGTCTGG + Intronic
967607341 3:191463154-191463176 AAGAAGAAAGAGAGAGAGAAAGG - Intergenic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
967959665 3:194910385-194910407 CCGGAGCAAGAGAGAGAGGCTGG + Intergenic
968124493 3:196148495-196148517 CAGAAGCAAGAGAGAGAGCGAGG - Intergenic
968256466 3:197277836-197277858 TAAAATTAAGAGAGAGAGCCGGG + Intronic
968493051 4:900814-900836 CAGAAGGAAGAGAGGGAGGGAGG + Intronic
969105709 4:4805668-4805690 CAGGCCAAAGAGTGAGAGGCTGG + Intergenic
969340704 4:6539142-6539164 AAAAAAAAAGAGAGAGAGGGCGG + Intronic
969404526 4:6981009-6981031 AAAAAAAAAGAGACAGAGGCCGG - Intronic
969908394 4:10419548-10419570 CAGAAGGAAGAGAGTGAGGGGGG - Intergenic
969971551 4:11053361-11053383 AAGAATAAAGAAAGAAACGCTGG - Intergenic
970015483 4:11507844-11507866 CAGGAGAAAGAGAGAGAGTGGGG + Intergenic
970170132 4:13281218-13281240 AAGAAGAAAGAAAGAGAGGTGGG - Intergenic
970258403 4:14195724-14195746 CAGGATAAAGAAAGAAAGGTGGG + Intergenic
970281084 4:14456431-14456453 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
970407477 4:15777959-15777981 CAGAGTTAAGAAAGAGAGGTAGG + Intergenic
970749641 4:19342200-19342222 CAGAAGCAAGAGAGCGAGGGAGG - Intergenic
970792616 4:19876535-19876557 CAGAAGCAAGACAGAGAAGCAGG + Intergenic
970971914 4:21994733-21994755 GAGAAACAAGAGAGAGTGGCAGG + Intergenic
970992009 4:22223504-22223526 CAGCCTAAAGACAGTGAGGCAGG - Intergenic
971037160 4:22706189-22706211 AAGAATAAAGTGTGTGAGGCCGG + Intergenic
971125706 4:23751806-23751828 AAGAATATAGGGAGAGAGGTGGG - Intergenic
971218339 4:24682412-24682434 CAGAATGAAAAGAGAGAGGGAGG - Intergenic
971316341 4:25571368-25571390 AAAAATAGAGAGAGAGAGACAGG - Intergenic
971508597 4:27395698-27395720 CAGAATCCAGAGAGAAAGACTGG - Intergenic
971715418 4:30169332-30169354 GAGAAAAGAGAGAGAGAGGTTGG - Intergenic
971861166 4:32108072-32108094 CAAAAGAAAGAGAGAGAGGGAGG + Intergenic
971957933 4:33446642-33446664 AACATTAAAGAGAGAGAGGGAGG + Intergenic
972149390 4:36069933-36069955 CAGAAGCAAGAGAGAGAGGGGGG - Intronic
972336478 4:38111233-38111255 CCAAGTAAAGAGGGAGAGGCAGG - Intronic
972466158 4:39359044-39359066 GGGAATAAAGGGAGAGAAGCAGG - Intronic
972521510 4:39861462-39861484 AAAAATAAAGAGAGAGAGACTGG + Intronic
972527194 4:39926223-39926245 AAAAATAAAAAGATAGAGGCCGG + Intronic
972683897 4:41333085-41333107 CAGAAGGAAGAGAGAGAAGGGGG + Intergenic
972790227 4:42364704-42364726 AAGAAAGAAGAGAGAGAGACTGG - Intergenic
972847300 4:43005143-43005165 CAGGAAAAAGAGAGTGAGGGGGG - Intronic
973695477 4:53486379-53486401 TAGAAAAAAGAGAGGGATGCTGG - Intronic
974015663 4:56646651-56646673 CAAAATGAAGAGAAAGAGGGAGG - Intergenic
974110624 4:57521204-57521226 CAGGAGAAAGAGAGAGAGTGGGG + Intergenic
974482420 4:62462862-62462884 CAGAAGAAAGAGAGTGAAGGTGG - Intergenic
974670284 4:65021574-65021596 CAAAAGGAAGAGAGAGAGACGGG + Intergenic
975607212 4:76167461-76167483 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
975828404 4:78343434-78343456 TAGAAGAGAGAGAGAGAGGGAGG - Intronic
976336322 4:83892161-83892183 AGGAATAAAGAGAGGGAGGAAGG - Intergenic
976532891 4:86175578-86175600 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
976602041 4:86946677-86946699 AAGAATAAAGAGAGTGGGCCGGG - Intronic
976697038 4:87927748-87927770 AAGAAAAAAGAGACAGAGGGAGG - Intergenic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
976909263 4:90280343-90280365 ATGAATGAAGAGAGAGAGGAAGG - Intronic
977118727 4:93069001-93069023 CAGAAACAAGAGAGAGAGGAGGG + Intronic
977126334 4:93173429-93173451 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977556889 4:98495929-98495951 GATAAGAAAGAGAGAGAGACAGG + Intronic
977789096 4:101077021-101077043 CAGAGTGAAGACACAGAGGCAGG + Intronic
978071643 4:104479826-104479848 AGGAATAAAGGGAGAGAGGGAGG - Intronic
978181985 4:105809429-105809451 CTGAATAAAGTGAGAGAGTAAGG - Intronic
978313022 4:107407166-107407188 CAGAAAAAAGAAAGAAAGGCTGG + Intergenic
978473962 4:109104719-109104741 CAGAAAAAAAAGAGAGAGAGAGG + Intronic
978591432 4:110328813-110328835 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
978625455 4:110680149-110680171 AAGAATAAAGAGAGAAAGGGAGG - Intergenic
978690568 4:111504539-111504561 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
978889391 4:113805084-113805106 CAGAAGAAAGAGAGTGAAGGAGG + Intergenic
979133707 4:117082173-117082195 AAGAATAAAGGGAAAGATGCTGG - Intergenic
979305604 4:119139547-119139569 CTGAATGAAGAGAGAGAGGTAGG + Intronic
980634597 4:135484371-135484393 AAGAAGAAAGAAAGAGAGGAAGG - Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981409911 4:144417700-144417722 CAGGAGGAAGAGAGAGAGGTGGG + Intergenic
981557198 4:146008229-146008251 AGGAAGAAAGAGAGAGAGGGAGG - Intergenic
981803100 4:148680868-148680890 CAGAATACAGGGACAGAGGGAGG - Intergenic
981819141 4:148866338-148866360 CAGCACACAGAGAGTGAGGCAGG + Intergenic
981953098 4:150434993-150435015 CAAAAGACAGAGAGAGAGGAAGG + Intronic
982013063 4:151125555-151125577 AGAAAGAAAGAGAGAGAGGCCGG + Intronic
982147187 4:152407727-152407749 CAGAATAAATAAATAGAGGGTGG - Intronic
982256842 4:153459172-153459194 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
982310128 4:153975706-153975728 CAGGAGAGAGAGAGAGAGGGAGG - Intergenic
982757788 4:159244099-159244121 AAAAATGAAGAGAGAAAGGCAGG + Intronic
983269647 4:165546313-165546335 AGGAATAAAGAAAGAGAGGCAGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983516886 4:168666844-168666866 CAGAAAAAAAAGAAAGAGACTGG + Intronic
983564685 4:169137143-169137165 CAGAATACAGAAAGAAAGGCAGG - Intronic
983571580 4:169214231-169214253 CAGAAGCAAGAGAGTGAGGGAGG - Intronic
983621271 4:169763797-169763819 AAAAAAAAAGAGAGAGAGACAGG + Intergenic
983658303 4:170106001-170106023 TAGGAGAAAGAGAGACAGGCGGG + Intergenic
983667913 4:170202904-170202926 CAGAACAAAGAGAGAGAAAAGGG - Intergenic
983702716 4:170617307-170617329 GGAGATAAAGAGAGAGAGGCAGG - Intergenic
983808604 4:172027519-172027541 CTGAAGAGAGAGAGAGAGACAGG - Intronic
983917834 4:173311551-173311573 CAGGAGCAAGAGAGAGAAGCAGG + Intronic
984189012 4:176582392-176582414 CAGGAGGAAGAGAGAGAGGTGGG - Intergenic
984256927 4:177400569-177400591 CAGGAGCAAGAGAGAGAGGAGGG + Intergenic
984355763 4:178655203-178655225 CAGGAGGAAGAGGGAGAGGCGGG - Intergenic
984428730 4:179621380-179621402 CAATAAAAAGAGTGAGAGGCAGG - Intergenic
984556916 4:181225612-181225634 GAGAAGAAAAAGAGAGAGACAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984781212 4:183527405-183527427 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
985371607 4:189291280-189291302 CAGAAGAGAGAGAGAGAGAGGGG - Intergenic
985932810 5:3072392-3072414 AAGGAGAGAGAGAGAGAGGCAGG - Intergenic
986024038 5:3833291-3833313 CAGAAGCAAGAGAGAGCGGGTGG - Intergenic
986027005 5:3860075-3860097 CAGAAGCCAGAGAGAGAGACAGG - Intergenic
986093572 5:4534915-4534937 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
986095117 5:4547102-4547124 GAAAAGAAAGAGAAAGAGGCTGG + Intergenic
986150799 5:5128999-5129021 CAGAAGAAAGAGAGAGAGAGGGG - Intergenic
986859466 5:11909692-11909714 CTGGATACAGTGAGAGAGGCTGG + Intergenic
987187986 5:15444665-15444687 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
987862480 5:23506092-23506114 CAGGAGGAAGAGAGAAAGGCGGG - Intergenic
987899062 5:23987492-23987514 GAGAAGAAACAGAGAGAGGCAGG - Intronic
988081870 5:26425622-26425644 GAGGATTAAGAGAGAGTGGCCGG - Intergenic
988216291 5:28277796-28277818 AAGAGAAAAGAGAGAGAGGGAGG - Intergenic
988251548 5:28764724-28764746 CAAAAGAGAGAGAGAGAGGGGGG + Intergenic
988318875 5:29667197-29667219 AAAAAAAAAGAGAGAGAGGAAGG + Intergenic
988390087 5:30616480-30616502 CAGAAGGAAGAGAGAGAGTGGGG + Intergenic
988848078 5:35150229-35150251 AAGAATAAAGAGAAAGAAGTGGG - Intronic
988907230 5:35802151-35802173 AAGAGTAAAGACAGAGAGGCAGG - Intronic
989285952 5:39700099-39700121 GAGAAAAGAGAGAGAGAGGCTGG + Intergenic
989314110 5:40056863-40056885 AGGAAGAAAGAGAGAGAGGGAGG - Intergenic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
989579865 5:43022152-43022174 CAGAAAAAAGAGAGAGAGATAGG + Intergenic
989817079 5:45749883-45749905 CAGTAAAGAGAGAGAGAGGGAGG + Intergenic
990061725 5:51658502-51658524 CAGAATTATGCAAGAGAGGCAGG - Intergenic
990304337 5:54480120-54480142 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
990384176 5:55243313-55243335 CAGAATAAAGGGAAAGATGTTGG + Intergenic
990658490 5:57985126-57985148 CAGGAAGAAGAGAGAGAGGTTGG - Intergenic
990802653 5:59622560-59622582 CAGAAGAAAGGGAGAGAGATCGG - Intronic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991202841 5:64014159-64014181 GAGAAAACAGAGAGAGATGCAGG - Intergenic
991245261 5:64503592-64503614 GAGAAGGAAGAGAGAGAGGAAGG + Intergenic
991304201 5:65159405-65159427 GAGGCTACAGAGAGAGAGGCAGG - Intronic
991316277 5:65310111-65310133 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
991522354 5:67515195-67515217 CAGGAGAAAGAGAGAGATGGGGG + Intergenic
991727860 5:69554228-69554250 CAGAAAAAAAATAGGGAGGCTGG - Exonic
991867097 5:71073648-71073670 CAGAAAAAAAATAGGGAGGCTGG + Intergenic
991972177 5:72151753-72151775 AAAAACACAGAGAGAGAGGCTGG - Intronic
992017403 5:72589751-72589773 AAGGAAGAAGAGAGAGAGGCTGG + Intergenic
992353076 5:75951012-75951034 TAGAATAAAGAGAGAAAGGATGG - Intergenic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
992528470 5:77633141-77633163 CAGAAAAAAGAAAGAGGGGGAGG + Intronic
992560245 5:77944886-77944908 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
993275505 5:85851418-85851440 CAGGAAAAAGAGAGAGAAGGAGG + Intergenic
993373398 5:87119483-87119505 GAGAAAAAAGAGAGAGAGCGAGG + Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
993555217 5:89328628-89328650 CAGGAGGAAGAGAGAGAGCCGGG + Intergenic
993642991 5:90428365-90428387 CAGAAGAAAGAGAAAGAGTTGGG + Intergenic
993916432 5:93748464-93748486 GAAAATAAAAAGACAGAGGCAGG + Intronic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994050726 5:95359431-95359453 CAGAAGGAAGAGAGAAAGGGAGG + Intergenic
994060884 5:95475427-95475449 CAGGAGCAAGAGAGAGAGGGGGG - Intronic
994077321 5:95667927-95667949 CAGGAGGAAGAGAGAGAGGTGGG - Intronic
994549907 5:101220356-101220378 TGGAATAAAGAGAGACATGCAGG + Intergenic
994575960 5:101580055-101580077 CAAGAGAAAGAGAGAGAGGGAGG - Intergenic
994650438 5:102520255-102520277 CAGAATAGAAAGACAGAGGGAGG + Intergenic
994723447 5:103407180-103407202 CAGGTTAAAGAGAGAGTGTCTGG - Intergenic
994849769 5:105039109-105039131 CAGAAGGAAGAGAGAGAGGAGGG - Intergenic
994900736 5:105765330-105765352 CAGATTACAGGGAGAGAGGTGGG + Intergenic
994987150 5:106950787-106950809 CAGAATAAAAGGAGAAAGGCGGG - Intergenic
995084540 5:108092271-108092293 CAGAAATTAGAGAGTGAGGCTGG + Intronic
995556579 5:113336089-113336111 AAAAAGAAAGAGAGAGAGACAGG + Intronic
995559579 5:113365817-113365839 CAGAAGGAAGAGAGAGAGCAGGG + Intronic
995740509 5:115350975-115350997 CAAGAGAAAGAGAGAGAGGGAGG + Intergenic
995810167 5:116097799-116097821 CAGGAACAAGAGAGAGAGGGAGG + Intronic
995962095 5:117854106-117854128 AAGAAAAGAGAGAGAGAGGCAGG + Intergenic
996148106 5:119999919-119999941 AGGGAGAAAGAGAGAGAGGCAGG + Intergenic
996380976 5:122862317-122862339 AAGAAAAAAAAGAAAGAGGCTGG + Intronic
996735721 5:126756317-126756339 TAGAATAAAAAAAGAGAGGCTGG - Intergenic
996876980 5:128250862-128250884 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
997110111 5:131065589-131065611 AAGAAGGAAGAGAGAGAAGCAGG - Intergenic
997224948 5:132202892-132202914 CAGAACAAAGAAAGAAAGGCGGG - Intronic
997281323 5:132648753-132648775 CAGAAGAGAGAGAGAGAGAAAGG + Intergenic
997757917 5:136417566-136417588 CAGAAGAAAGAGTGTGAGCCAGG + Intergenic
998209051 5:140179957-140179979 AAGAAAAAAGAGAGTGAGGCTGG - Intronic
998609286 5:143670600-143670622 CAGGAGGAAGAGAGAGAGGGTGG + Intergenic
998769856 5:145530580-145530602 AAGAATAAGGAGGGAGAGACAGG + Intronic
999043367 5:148441014-148441036 TAAAATAAAGAGAGTGAGTCAGG - Intronic
999290831 5:150424864-150424886 GAGAAGAGAGAGAGAGTGGCCGG + Intergenic
999363061 5:151002449-151002471 TAGGATAAAGAAAAAGAGGCTGG + Intergenic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
999586275 5:153093036-153093058 CAAAATAAAATGAGAGAGGTAGG + Intergenic
999595535 5:153199863-153199885 AAGAAAAAAGAGAGAGAGGGAGG + Intergenic
999692676 5:154162327-154162349 AAGAAGGAAGAGAGAGAGGAGGG + Intronic
1000006100 5:157186377-157186399 AAAAAGAGAGAGAGAGAGGCGGG + Intronic
1000222609 5:159228262-159228284 CAAAAGAAAGAAAGAGAGGCTGG - Intergenic
1000452620 5:161408753-161408775 AAGGATAAAGAGAGAGATGAGGG + Intronic
1000875389 5:166631564-166631586 TAGCATAAAGAGAGAGAACCCGG - Intergenic
1000983753 5:167844947-167844969 CAGCATAGAGGGAGAGAGGGAGG - Intronic
1001618916 5:173065600-173065622 GGGAATAAAGAGAGAGAGGGAGG - Intronic
1001919452 5:175588783-175588805 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1002392655 5:178927992-178928014 CAGGAGCAAGAGAGAGTGGCAGG + Intronic
1002551353 5:179995197-179995219 CTGGAGAGAGAGAGAGAGGCAGG - Intronic
1002899508 6:1399259-1399281 GAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1003010917 6:2426903-2426925 AAGAATAGAGAGAGAGAGATGGG + Intergenic
1003013012 6:2444054-2444076 CATAATAAATAGAGAGAGTAGGG + Intergenic
1003144274 6:3496483-3496505 AGGAATAGAGAGAGAAAGGCAGG - Intergenic
1003380407 6:5619805-5619827 AAGAATGAAGAGAGGGAGACAGG - Intronic
1003490242 6:6614909-6614931 ATGAAAAAAGAGGGAGAGGCCGG + Intronic
1003756646 6:9128462-9128484 CAGGATCAAGAGAGAGAGGAGGG - Intergenic
1004081235 6:12395457-12395479 GAGGACAAAGAAAGAGAGGCAGG + Intergenic
1004135605 6:12963105-12963127 CAGAATTCAGAGAAAGAGACAGG + Intronic
1004199318 6:13533123-13533145 CAGAATAAAGAGTGAGTACCTGG + Intergenic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004458495 6:15813906-15813928 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1004481185 6:16020833-16020855 CAGAAGCCAGAGAGAGAGGAGGG - Intergenic
1004506054 6:16247669-16247691 AAGAATTAAGAGATACAGGCCGG - Intronic
1004545248 6:16592108-16592130 CAGAATAATGAGTGACAGGCTGG - Intronic
1004576304 6:16898768-16898790 CAAAATAGAGAGAGAGAGGTGGG - Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004690895 6:17991150-17991172 AAAAATAAAGAAAGAGAGGAAGG + Intergenic
1005000504 6:21235504-21235526 AAAAATGAAGAGAGAGAGGGAGG + Intergenic
1005279110 6:24252109-24252131 CAGAATAAAAATCCAGAGGCAGG - Intronic
1005627088 6:27672887-27672909 GAGTACAAAGTGAGAGAGGCAGG - Intergenic
1005741852 6:28799251-28799273 AAGAAAGAAGAGAGGGAGGCAGG + Intergenic
1005816962 6:29561306-29561328 AAGAGTAAAGAGAGAGAGAGAGG - Intronic
1005850767 6:29819055-29819077 GAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1005857648 6:29874780-29874802 GAGAAGAAAGAGAGAGAGGGAGG - Intergenic
1005943315 6:30577685-30577707 AAGAAAAAAAAGAGAGAGACAGG + Intronic
1006034230 6:31199067-31199089 AAGAAGAGAGAGAGAGAGGAAGG + Intronic
1006179149 6:32143559-32143581 AAGAAAAAAGAAAAAGAGGCTGG + Intergenic
1006466734 6:34199799-34199821 CAAAAAAAAAAGAAAGAGGCCGG - Intergenic
1006536409 6:34702594-34702616 AAGAATCATGAGACAGAGGCCGG + Intergenic
1006564795 6:34946275-34946297 TTGTAAAAAGAGAGAGAGGCCGG - Intronic
1006603279 6:35239573-35239595 CAGGAAAGAGAGAGAGAGACAGG + Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007499884 6:42288588-42288610 AAAAAAAAAGAGAGAGAGACGGG + Intronic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1008754551 6:54778546-54778568 CAGGAGGAAGAGAGAGAAGCGGG + Intergenic
1009267876 6:61579034-61579056 CAGCAGAAAGAGAGGGAGGTGGG + Intergenic
1009323483 6:62320047-62320069 CAGAATAAAAAAGGTGAGGCAGG - Intergenic
1009608472 6:65905514-65905536 CAGAAGAAAGACAGTGAGGGGGG + Intergenic
1009652977 6:66499901-66499923 CAGAAGGAAGAGAGAGAGGAAGG - Intergenic
1009746183 6:67819500-67819522 GAGGAAAAAGAGAGAGAGGGAGG - Intergenic
1010290013 6:74124604-74124626 AAGAAGAAAGAGAAAAAGGCAGG - Intergenic
1010807110 6:80250347-80250369 CAGAAGATTGAGACAGAGGCTGG - Intronic
1010954434 6:82074008-82074030 AAGATTAAAGAAATAGAGGCTGG + Intergenic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011142771 6:84178344-84178366 CAAAATAAAAAGAGAGTAGCTGG + Intronic
1011216239 6:85008862-85008884 CAGGAGAAAGAGAGAGAGCATGG - Intergenic
1011602373 6:89071662-89071684 AAAAACAAAGAGAGAGAGACAGG - Intergenic
1011672775 6:89699735-89699757 AAAAATAAAGAGGGAGAGGGTGG + Intronic
1011899309 6:92272342-92272364 TAGAATAAAGACAGAGGGGAGGG - Intergenic
1011996775 6:93599474-93599496 CAGAAGCAAGAGAGAGAGTTGGG - Intergenic
1012471597 6:99578624-99578646 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1012627887 6:101426687-101426709 TAGATTAGAAAGAGAGAGGCAGG - Intronic
1012957414 6:105586393-105586415 CGAGAGAAAGAGAGAGAGGCAGG + Intergenic
1012961038 6:105621930-105621952 CAGGATAAAGAGAAAGCGCCAGG - Intergenic
1013066069 6:106685477-106685499 CAAAAGACAGAAAGAGAGGCTGG + Intergenic
1013378684 6:109544539-109544561 CAGGAGAAAGAGAGTGAGGTGGG - Intronic
1013536517 6:111067578-111067600 AAGAAAAAAGAAAGAAAGGCAGG - Intergenic
1013650541 6:112190269-112190291 CAGGCTAAAGAGAGAGAAGGCGG - Intronic
1013689759 6:112627552-112627574 AAGAATAAAGAATGGGAGGCTGG - Intergenic
1014203386 6:118628496-118628518 GAAAATAAAGAGAAAAAGGCTGG + Intronic
1014234751 6:118941084-118941106 CAGAACAGAGAGAGAGAGAGAGG + Intergenic
1014247854 6:119085863-119085885 CAGGAGAAAGAGAGAGTGGGGGG + Intronic
1014264069 6:119254360-119254382 CAGAAAAAAGAGGGAGAGTAAGG + Intronic
1014450216 6:121573151-121573173 CAGAAGAAAGAGTGAGATGTGGG - Intergenic
1014466077 6:121758801-121758823 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1014490604 6:122057197-122057219 CAGATAAAGGGGAGAGAGGCAGG + Intergenic
1014745065 6:125191207-125191229 GAGAATAAAGAAAGCGTGGCTGG - Intronic
1015230309 6:130907658-130907680 CAGAATAAAAAAAGAGAGTAGGG + Intronic
1015426137 6:133070045-133070067 GAGAATGAAGAGAGTGAGGATGG + Intergenic
1015645251 6:135380035-135380057 AAGAAGAAAGAGAGGGAGGGAGG - Intronic
1016028495 6:139313370-139313392 CAGATTAAAAAGAGAAAGACAGG - Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016138431 6:140576776-140576798 GAGAAAAAAGAGAGAGAGGATGG - Intergenic
1016360961 6:143267038-143267060 GAAAAGAAAGAGAGAGAAGCAGG - Intronic
1016403703 6:143707907-143707929 CAGGAGGAAGAGAGAGAGGGAGG + Intronic
1016523315 6:144971205-144971227 CAGGCTAATGAGAGAGAAGCTGG + Intergenic
1017189847 6:151641342-151641364 CAGGAGCAAGAGAGAGAGGAAGG - Intergenic
1017371181 6:153710988-153711010 CAGGAGGAAGAGAGAGAGACGGG + Intergenic
1017629546 6:156383081-156383103 CAGGAACAAGAGAGAGTGGCGGG - Intergenic
1017648195 6:156557871-156557893 CCAAATAAAGACAGAGGGGCAGG + Intergenic
1017663423 6:156695787-156695809 CAGAAGAACAAGAGAGAAGCAGG - Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017999099 6:159562982-159563004 CAAAATAAAAAGAAAGAGGTTGG + Intergenic
1018305739 6:162453310-162453332 AAGGAAAAAGAGAGAGAGGAGGG - Intronic
1018331172 6:162728331-162728353 CAGAAACCAGAGAGTGAGGCTGG - Exonic
1018602790 6:165563213-165563235 AAGAAAAAAGAAAGAGAGGAAGG + Intronic
1018605930 6:165597862-165597884 CAGAAAAAAGACTGTGAGGCTGG + Intronic
1018971904 6:168535978-168536000 CAGAATCCAGAGAGAACGGCCGG - Intronic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1019404758 7:877502-877524 CAGCAGGAAGAGAGAGAGACGGG - Intronic
1019841272 7:3447998-3448020 AAGAATAAAGATATATAGGCCGG - Intronic
1019923306 7:4176463-4176485 CACAATAAAAAAAGAAAGGCTGG - Intronic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020437491 7:8180824-8180846 AAAAAAAAAGAGAGAGAGACTGG - Intronic
1020622666 7:10536549-10536571 CAGAATAAAAAGAGAAAGAAGGG + Intergenic
1020932180 7:14411757-14411779 CAGAAAAAAAAGAAAGAGGTAGG - Intronic
1021298577 7:18941184-18941206 AAGAATAACGGGAGGGAGGCAGG - Intronic
1021334549 7:19383124-19383146 GAAAAGAAAGTGAGAGAGGCGGG - Intergenic
1021362531 7:19733671-19733693 AAAAATACAGAGGGAGAGGCAGG + Intronic
1021602988 7:22382865-22382887 CAGAATGATGAGGGAGAGGAAGG - Intergenic
1022090350 7:27103924-27103946 TAGAAAAAAAAGAGAGAGGGAGG - Intergenic
1022162628 7:27726936-27726958 CCAAAAAAAGAGAGGGAGGCAGG + Intergenic
1022357013 7:29625663-29625685 AAGAAAGAAGAGAGAGAGGAAGG + Intergenic
1022595674 7:31711598-31711620 AAAAATTAAGAGAGAGAGGGTGG - Intergenic
1022712437 7:32864526-32864548 CAGGAGCAAGAGAGAGAGGTGGG + Intergenic
1022910298 7:34894495-34894517 CAGGAGCAAGAGAGAGAGTCGGG - Intergenic
1022910562 7:34896478-34896500 CAGGAGCAAGAGAGAGAGGTGGG - Intergenic
1023130663 7:36999576-36999598 CAGAATAAAGAAAGAGAAATAGG + Intronic
1023269474 7:38445938-38445960 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
1023410951 7:39888665-39888687 AAGAATAGAGAGAGAGAGAGAGG + Intergenic
1023546109 7:41319076-41319098 AAAAATAAAGAGAGACAGGAAGG + Intergenic
1023704658 7:42929056-42929078 AATAATAAAGAGACCGAGGCAGG - Intronic
1023738867 7:43259860-43259882 TAGAATAATGAGAGAGAGAATGG + Intronic
1024066786 7:45744224-45744246 GAGAAGCAAGAGAGAGAAGCGGG + Intergenic
1024444499 7:49461263-49461285 AAGAAGAGAGAGAGAGAGGGAGG + Intergenic
1025049298 7:55721031-55721053 CAGGAGCAAGAGAGAGAGGGTGG - Intergenic
1025171671 7:56763832-56763854 AAGAATCATGAGAGAGAGGGAGG + Intergenic
1025939958 7:66068678-66068700 CAGGAGCAAGAGAGAGAGGAGGG + Intergenic
1026153859 7:67810732-67810754 TCTAAAAAAGAGAGAGAGGCCGG - Intergenic
1026229216 7:68468921-68468943 AAGAAGAAAAAGAGAGAGGGAGG + Intergenic
1026250546 7:68666224-68666246 AAGGAGACAGAGAGAGAGGCAGG - Intergenic
1026280749 7:68919796-68919818 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1026622932 7:71966518-71966540 CAGGAGACAGAGAGAGAGGAGGG - Intronic
1026763300 7:73142933-73142955 AAAAAAAAAGAGAGAGAGGGAGG + Intergenic
1027039769 7:74952715-74952737 AAAAAAAAAGAGAGAGAGGGAGG + Intergenic
1027083875 7:75249669-75249691 AAAAAAAAAGAGAGAGAGGGAGG - Intergenic
1027473862 7:78605916-78605938 CAGCATCAAGAGAGAAAGACAGG + Intronic
1027565391 7:79785665-79785687 AAGCATAAAGAAAGAAAGGCTGG + Intergenic
1027775082 7:82454914-82454936 CAGGAAAATGAGACAGAGGCTGG + Intergenic
1027811347 7:82904269-82904291 CAGACAAAAGAGATAGAGACAGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027938027 7:84633845-84633867 CACAATAAACAAAGAAAGGCAGG + Intergenic
1028453341 7:91010860-91010882 AAAAAGAAAGAGAGAGAGGGAGG - Intronic
1028519311 7:91712250-91712272 CAGACAAAAAAGAGGGAGGCTGG + Intronic
1028977463 7:96930016-96930038 TAGAATAAATAGAGGGAGACAGG - Intergenic
1029157934 7:98530542-98530564 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1029187284 7:98748279-98748301 AAGGAGAAAGAGGGAGAGGCAGG + Intergenic
1029241431 7:99166010-99166032 CAGAAGGAAGAGAGAGAAGGGGG - Intergenic
1029469296 7:100744011-100744033 AAGAACAAAGAGATATAGGCTGG - Intronic
1029621809 7:101694803-101694825 AAAAAAAAAGAGAGAGAGACAGG - Intergenic
1029681313 7:102112821-102112843 CAGAAATAAAAAAGAGAGGCTGG - Intronic
1029871381 7:103696653-103696675 CAGAATTAGGAGTGAGAGGATGG - Intronic
1029933511 7:104398703-104398725 CATAATAAGGTGAGACAGGCAGG - Intronic
1030272625 7:107686389-107686411 AAGAAAAAAGAGAGAGAGGAAGG - Intronic
1030280583 7:107770552-107770574 CAGAGTTAAGAAACAGAGGCTGG - Intronic
1030365485 7:108641221-108641243 AAAAAGAAAGAGAGAGAGGGAGG - Intergenic
1030600290 7:111584378-111584400 CAGAACAAAGCGGTAGAGGCAGG - Intergenic
1030720521 7:112865275-112865297 CAAAAAAAAGAGAGAGATGGGGG - Intronic
1030737574 7:113067832-113067854 CTGAACAAAGAGAGACAGGGAGG + Intergenic
1030834616 7:114266502-114266524 CAGAAGCAAGAGAGAGAGTTGGG + Intronic
1031419530 7:121533676-121533698 CTGAACAAAGAGAGACAGGGAGG - Intergenic
1031612947 7:123847824-123847846 CAGAATAAAGAGAAAAAAGGGGG - Intronic
1031735885 7:125360896-125360918 CTGAAAAAAGGGAGAGAGACCGG + Intergenic
1032298976 7:130668972-130668994 CAGTCTCAAGAGAGCGAGGCGGG + Exonic
1032364125 7:131283396-131283418 CAGTAAAGAGAGAGAGAGGAAGG - Intronic
1032499274 7:132387917-132387939 CAGCATAGAGCCAGAGAGGCTGG + Intronic
1032798962 7:135302872-135302894 AAGAAAAAAGAGAGAGAGGAAGG + Intergenic
1032974523 7:137207137-137207159 GAAAAGAAAGAGAGAGAGGAAGG - Intergenic
1033078990 7:138277003-138277025 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1033144196 7:138856942-138856964 CAGAAGAAAAAGACAGAGGAAGG + Intronic
1033321175 7:140340939-140340961 AAAAATAGAGAGAGAGAGCCAGG + Intronic
1033827390 7:145208144-145208166 CAGCATACAGAGAGATTGGCTGG + Intergenic
1033985815 7:147224106-147224128 CAGATTAAAGAGACAGATGAGGG - Intronic
1034063290 7:148112738-148112760 GAGAATATAGAGAAAGGGGCTGG + Intronic
1034177706 7:149113269-149113291 GGTAAAAAAGAGAGAGAGGCCGG - Intronic
1034551708 7:151824848-151824870 CAGAAGAAAGAGAGGGAAGGGGG - Intronic
1034568627 7:151936152-151936174 AAAAATAAAAGGAGAGAGGCTGG - Intergenic
1034689142 7:153000030-153000052 CAGGAGAGAGAGAGAGAGGGAGG + Intergenic
1034740674 7:153470849-153470871 CTGAAGTCAGAGAGAGAGGCAGG + Intergenic
1035366987 7:158355434-158355456 CAGGAGAGTGAGAGAGAGGCAGG - Intronic
1035423011 7:158745135-158745157 CAGAATAATGAGACAGGGTCAGG + Intronic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036159633 8:6375173-6375195 AAAAAAAAAGAGAGAGAGACAGG - Intergenic
1036700464 8:11010158-11010180 CAGGAGGAAGAGAGAGAAGCAGG + Intronic
1036791729 8:11725636-11725658 CAGAGTGAAGAGCGAGGGGCAGG - Intronic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037292033 8:17361204-17361226 AAGAAGAAAGAGAGCAAGGCTGG - Exonic
1037480886 8:19304074-19304096 CAGGATGAAGAGAGAGAGAGTGG + Intergenic
1037529544 8:19759174-19759196 TAAAAGAAAGAGATAGAGGCCGG + Intergenic
1037654750 8:20873289-20873311 CATGCTAAGGAGAGAGAGGCTGG - Intergenic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1037867447 8:22457112-22457134 CAGAATATTGAGAGAGGGGAAGG - Intronic
1037929958 8:22873116-22873138 GAGTATAAAGAGAAAGGGGCTGG + Intronic
1038319261 8:26513319-26513341 AGGAATATAGAGAGAGACGCAGG - Intronic
1038650168 8:29395286-29395308 AGGAAAAAAGAGAGAGAGGGAGG - Intergenic
1038948279 8:32385596-32385618 CAGAAGCAAGAAAGAGAGCCAGG + Intronic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039434716 8:37552121-37552143 TAGAAGACAGAGAGAGAGGCTGG + Intergenic
1039562350 8:38522801-38522823 GAGAAAGAAGAGAGAGAGGAAGG - Intronic
1039654933 8:39394022-39394044 CACAAAAAAGAGAGAGATGGGGG - Intergenic
1040002346 8:42588494-42588516 GAAAATAAAGAAACAGAGGCTGG + Intergenic
1040079430 8:43272338-43272360 CAGAAGAAAGAGTGAGAAGAAGG + Intergenic
1040523755 8:48199945-48199967 CAGAAAGAAGGGAGAGAGGGAGG - Intergenic
1040564804 8:48555894-48555916 CAAAAGAAAGAGAAAGAGGAGGG - Intergenic
1040877091 8:52165336-52165358 CTGAATAGAGAGAGAGAGCATGG - Intronic
1041098130 8:54369853-54369875 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1041758363 8:61338136-61338158 CAAAATAAAGTGAGAGAAGATGG - Intronic
1042072464 8:64950667-64950689 CAAAAGGAAGAGAGAGAGGGTGG + Intergenic
1042077370 8:65011050-65011072 GAGGAAAAAGAGAGAGAGGAAGG - Intergenic
1042513916 8:69640066-69640088 CAAAAAAAAGAGAGAGAGAGAGG + Intronic
1042552353 8:70005213-70005235 AGGAAGAAAGAGAGAGAGGAAGG + Intergenic
1042613084 8:70619104-70619126 AAAAATAAAGAGAGAGAGAAAGG - Intronic
1043097225 8:75990450-75990472 AAAAAGAAAGAGAGAGAGGAAGG + Intergenic
1043185078 8:77138158-77138180 CAGAAGGAAGACAGAGGGGCAGG - Intergenic
1043834119 8:85027001-85027023 AAGAAGAAAGAAAGAAAGGCTGG + Intergenic
1043883220 8:85568423-85568445 CAGAAGAAAGAGAGAGGGAGAGG + Intergenic
1044281827 8:90365507-90365529 GAGAAGAAAAAGAGAGAGGAAGG - Intergenic
1044965251 8:97568187-97568209 CAGGGAGAAGAGAGAGAGGCTGG + Intergenic
1045306159 8:100958172-100958194 AAAAAAAAAGAGAGAGAGACAGG - Intergenic
1046048300 8:108988772-108988794 AAAGAGAAAGAGAGAGAGGCAGG + Intergenic
1046200940 8:110926913-110926935 AATAATATAGAGAGAGAGGAGGG + Intergenic
1046332277 8:112734256-112734278 AAGAAGAAAGGGAGAGAGGAAGG + Intronic
1046346704 8:112938293-112938315 AAGAATAAAGAGAAAGTTGCAGG - Intronic
1046595417 8:116255758-116255780 CAGAACAAAAAGATAGAGGCAGG + Intergenic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1046735021 8:117767706-117767728 CAGAAGGAAGAGAGAGAAGGGGG - Intergenic
1046918919 8:119706859-119706881 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1047099672 8:121663037-121663059 CAGAAGAAAGAGAGAAAGGTGGG + Intergenic
1047306164 8:123654714-123654736 CAGAATCACGAGAGAGAGTGAGG + Intergenic
1047425977 8:124747521-124747543 AAGAAGAAAGAGAGAGAGAGAGG - Intergenic
1047591430 8:126331184-126331206 CAGAACTAAGAGAGAAAGGGAGG + Intergenic
1047616594 8:126567756-126567778 AACAAGAAAGAGAGAGAGGGAGG - Intergenic
1047643001 8:126840562-126840584 CACAATAAAGAGAGTAAGGGAGG + Intergenic
1047688116 8:127321892-127321914 CAGGACCAAGAGAGAGAGGGAGG - Intergenic
1047711117 8:127553440-127553462 CAGTAGCAAGAGAGAGAGGCAGG - Intergenic
1047948846 8:129910952-129910974 CAAAACAATGGGAGAGAGGCCGG - Intronic
1048074454 8:131053918-131053940 AAGAAAAAAGGGAGAGAGGGAGG - Intergenic
1048146927 8:131854164-131854186 CAGAAGCAAGAGAGAGAGGGTGG - Intergenic
1048292375 8:133190924-133190946 AAAAAAAAAGAGAGAGAGGCAGG + Intergenic
1048591553 8:135825286-135825308 AGGAAGAGAGAGAGAGAGGCAGG - Intergenic
1048755908 8:137737961-137737983 GAGAAGGAAGAAAGAGAGGCAGG + Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1049862168 8:144906902-144906924 GAGAAAAAAAAGAGAGAGGGAGG - Intergenic
1050052128 9:1613639-1613661 CAGAATAAAGAGAGATAGCCTGG + Intergenic
1050128031 9:2379831-2379853 CAGAAGCAAGAGAGGGAGGGAGG - Intergenic
1050166753 9:2772504-2772526 AAGAAAAAAGAGAGAGAAACAGG + Intronic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1050552723 9:6761798-6761820 AAGAAAAAAGAGACAGAGGTTGG - Intronic
1050831170 9:10015710-10015732 CAGAAAGAAGAGAAAGAGGTGGG + Intronic
1050839584 9:10131131-10131153 AGGAATAAAGAGAGTGAGGATGG + Intronic
1050876205 9:10640065-10640087 CAGAAGGAAGAGAGAGAGAAGGG + Intergenic
1051168832 9:14296957-14296979 TAGAAGAAAAAGAGAAAGGCGGG - Intronic
1051274651 9:15387166-15387188 CAGCAGGAAGAGAGAGAGGAGGG - Intergenic
1051423311 9:16910160-16910182 CTGAACAAAGACACAGAGGCAGG + Intergenic
1051453606 9:17226861-17226883 CAGGAGCAAGAGAGAGAGACAGG + Intronic
1051610325 9:18955745-18955767 CAGAGAAAAGTGAGAGTGGCAGG - Intronic
1051657346 9:19395717-19395739 AAGAAGAAAGAGAGAGAGAGAGG - Intergenic
1051715294 9:19976429-19976451 CAGAAGAGAGAGAGTGAAGCAGG - Intergenic
1051811432 9:21054084-21054106 CAGGAGAAAGAGAGAGAGAAAGG - Intergenic
1051919928 9:22252555-22252577 CAGGAGAAAGAGAGAGATGGGGG + Intergenic
1052284005 9:26763786-26763808 CAGAAGGAAAAGAGAGAGGAAGG - Intergenic
1052416502 9:28184589-28184611 GAGAAAAAAGAGAGAGAGATGGG + Intronic
1052702076 9:31949799-31949821 CAGGATAAAGAGAGAGAGAGGGG + Intergenic
1052998661 9:34565392-34565414 CAGAGGAAAGGGAGAGAGACAGG - Intronic
1055108151 9:72533775-72533797 GAGAGAAAAGAGAGAGAGGAAGG - Intronic
1055438062 9:76312105-76312127 AAGAATGGAGAGAGGGAGGCAGG + Intronic
1055462978 9:76536867-76536889 AAGAAGAGAAAGAGAGAGGCAGG + Intergenic
1055618061 9:78093826-78093848 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1056082104 9:83106255-83106277 AAGAATAAACAGAGAGATACGGG - Intergenic
1056115539 9:83437936-83437958 CAGGATAAAAAGAGAGAAGGGGG + Intronic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056571399 9:87819503-87819525 AAGAAAAAAGAGAGAAAGGAAGG - Intergenic
1057097094 9:92320901-92320923 AAGAATATACAGATAGAGGCCGG - Intronic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1057609259 9:96526069-96526091 AAGAAAAAAAAGAGATAGGCCGG + Intronic
1057779768 9:98040138-98040160 CAAAGGAAAGAGAGAGATGCCGG - Intergenic
1057917167 9:99065699-99065721 ATGAATAAAAAGAGAGAGACTGG + Intronic
1058309393 9:103483160-103483182 CAGGAGAGAGAGAGAGAGGTTGG - Intergenic
1058353011 9:104048903-104048925 CAGACTTTAGAGAGAGAGGGAGG + Intergenic
1058499212 9:105593221-105593243 CAGGAAGAAGAGAGAGAGGGAGG + Intronic
1058510409 9:105711917-105711939 CAGAAAAAAAAGAGAGAGAAGGG - Intronic
1058569576 9:106326236-106326258 GAGAATCAAGAGAGGGAGGGAGG + Intergenic
1058961104 9:109993718-109993740 GAGAAGAAAGGGAGAGAGGAAGG - Intronic
1059119221 9:111627103-111627125 CAGAAGACAGAGGCAGAGGCTGG - Intergenic
1059181116 9:112213304-112213326 CAGTAGAAAGGGAGAGGGGCAGG + Intergenic
1059203377 9:112440308-112440330 AAAAAGAGAGAGAGAGAGGCAGG + Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059582464 9:115566695-115566717 AAGGAAAAAGAGAGAGAGGAAGG - Intergenic
1060042927 9:120316314-120316336 TAGAAAAAAGTGGGAGAGGCAGG + Intergenic
1060436030 9:123593948-123593970 CAGGAGAAAGAGAGAGAGAGGGG - Intronic
1061385632 9:130287806-130287828 AAGAGGAAGGAGAGAGAGGCAGG + Intronic
1061528026 9:131184324-131184346 AAAAAAAAAAAGAGAGAGGCCGG - Intronic
1062060186 9:134491199-134491221 AATAACAAAAAGAGAGAGGCGGG + Intergenic
1062228482 9:135467320-135467342 CAAAAAAAAAAGAGAGATGCAGG - Intergenic
1062437679 9:136553842-136553864 CAGATGACAGACAGAGAGGCCGG - Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1185487470 X:494161-494183 CGGTTTAAAAAGAGAGAGGCTGG - Intergenic
1185495496 X:551233-551255 AAGAAGAGAGAGAGAGAGGAAGG - Intergenic
1185545366 X:939389-939411 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1185575348 X:1168102-1168124 AAGAAAAAAGAGAGAGATGGAGG - Intergenic
1185683752 X:1910188-1910210 AGGAAGAAAGAGAGAGAGGGAGG - Intergenic
1185738133 X:2508758-2508780 GAGAAGAAAGAAAGAGAGGAAGG - Intergenic
1185787479 X:2903078-2903100 GAGAAGAAAGAGAGAGAGAGAGG - Intergenic
1185940591 X:4314664-4314686 CAGAGAGAAGAGAGAGAGACAGG + Intergenic
1186020124 X:5245428-5245450 AAGAAGAAAGAGAGAAAGGGAGG - Intergenic
1186205563 X:7196741-7196763 CAAAATACAGATAGAGAGACAGG - Intergenic
1186351433 X:8743602-8743624 CTAAAAAAAGATAGAGAGGCCGG + Intergenic
1186494580 X:10002071-10002093 CAAAAAAGACAGAGAGAGGCGGG + Intergenic
1186626235 X:11296735-11296757 GAGAATAGAAAGAGAGAGGAAGG - Intronic
1186672821 X:11783985-11784007 CAGGAGCAAGAGAGAGAGGTGGG - Intergenic
1186701025 X:12090284-12090306 CAGGAGCAAGAGAGAGAGGTGGG - Intergenic
1186821808 X:13296489-13296511 CAGAAGAAAGACAAAGAAGCAGG - Intergenic
1186834338 X:13422495-13422517 GAGAAAAGAGAGAGAGAGGGAGG + Intergenic
1186862975 X:13691363-13691385 AAGATTAAAGAGTGAGTGGCTGG + Intronic
1187060130 X:15778748-15778770 CAGAAGAGAGAGAGAGAGATGGG + Intronic
1187414241 X:19078860-19078882 CAAAATCAAGAGACAGAGGGAGG + Intronic
1187863549 X:23703728-23703750 AAGCAGAAAGAGAGAGTGGCCGG - Exonic
1187959718 X:24557174-24557196 CAGAATAAATAAAGCCAGGCTGG - Intergenic
1188450124 X:30300540-30300562 GAAAAGAAAGAGAGAGGGGCAGG + Intergenic
1188933500 X:36144671-36144693 CAGAACAAAGAGACAGAAGAAGG + Exonic
1188963861 X:36526809-36526831 CAGAAGGAAGAGAGAGAGAGAGG + Intergenic
1189025202 X:37387532-37387554 CAGGAGGAAGAGAGAGAGGGGGG + Intronic
1189069797 X:37851235-37851257 CAGGAAGAAGAGAGAGAGGAGGG - Intronic
1189153422 X:38730453-38730475 CAGTTTACACAGAGAGAGGCAGG - Intergenic
1189154321 X:38741417-38741439 AAGAAGAAAGAGAGAGAGGGAGG - Intergenic
1189166526 X:38866488-38866510 AAGAATAAAAAGAGAAAGGAGGG - Intergenic
1189628964 X:42931603-42931625 CAGAAGAAAGAGAGAGAAGGGGG + Intergenic
1189656506 X:43250498-43250520 CAGGAGCAAGAGAGAGAGGTAGG + Intergenic
1190015251 X:46820664-46820686 CAGAACAGAGAGAGAGAGAGAGG + Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190047538 X:47124738-47124760 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190080910 X:47356179-47356201 CAAAAAAAAAAAAGAGAGGCCGG - Intergenic
1190482989 X:50896339-50896361 CGGAGTCAAGAGAGAGAGACAGG + Intergenic
1191801915 X:65090931-65090953 CAGGAGCAAGAGAGAGACGCAGG - Intergenic
1192057510 X:67787356-67787378 CTGATTATAGAGAAAGAGGCTGG - Intergenic
1192360666 X:70436792-70436814 AAAAATGAAGAGAGAGAGGGTGG + Intergenic
1192397102 X:70793523-70793545 CAGAAGAAAGAGAGTGAGGGTGG - Intronic
1192418034 X:71002063-71002085 CAAAAGAAAGAAAGAGAGGAAGG + Intergenic
1193019728 X:76778940-76778962 CAAAATAAAGGGATAGAAGCAGG - Intergenic
1193119406 X:77807682-77807704 AAGAAGAAAGAAAGAAAGGCAGG - Intergenic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1193286353 X:79719706-79719728 GAGTGTAAAGCGAGAGAGGCTGG - Intergenic
1193650532 X:84125556-84125578 AAAAATAAAGAGAAAAAGGCTGG + Intronic
1193965269 X:87976837-87976859 CAGGAGAAAGAGAGAGAAGTGGG - Intergenic
1194044489 X:88984872-88984894 CAAAATACAGAGAGAAAGTCTGG - Intergenic
1194070978 X:89325873-89325895 GAGAACAAAGAGAGAGAAGAAGG - Intergenic
1194072789 X:89348480-89348502 CAAGAGAAAGAGAGAGAGGGAGG - Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194326325 X:92522309-92522331 CAGAAGAAAAAGAGAGAGATGGG + Intronic
1194347823 X:92787395-92787417 TAGAAGCAAGAGAGAGAGGCAGG + Intergenic
1194402238 X:93452775-93452797 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1194418231 X:93638920-93638942 CAAAATGAAGAGAGAGAGGAGGG - Intergenic
1194640593 X:96399393-96399415 CAGAATGAAGCTAGAGAGGAAGG - Intergenic
1195022809 X:100846634-100846656 CAGGAGAGAGAGAGAGAGGGAGG - Intronic
1195497182 X:105550139-105550161 ATTAATAAAGAGGGAGAGGCAGG + Intronic
1195617558 X:106924807-106924829 AAGAAGAAAGAGAGAGATGGGGG - Intronic
1195707789 X:107750575-107750597 CAGAACAAGGAGAGAGAGCTGGG + Intronic
1196235903 X:113279281-113279303 CAGAATAAAGAAAGGAAGGAAGG + Intergenic
1196244015 X:113377568-113377590 AAGGATAAATATAGAGAGGCGGG - Intergenic
1196364413 X:114907702-114907724 CAAAAGAAAGAGAGAAAGGAAGG - Exonic
1196601297 X:117604452-117604474 GAGCAGAAAGAGAGAGAGGGGGG - Intergenic
1196676527 X:118426403-118426425 CATAATAAAAAGACAGTGGCCGG + Intronic
1196715166 X:118803917-118803939 GAAAAAAAAGAGAGAGAGGAAGG - Intergenic
1197014735 X:121609764-121609786 AAGAATGAAGGGAGAGAGGGAGG + Intergenic
1197133288 X:123030935-123030957 GAGAAAGATGAGAGAGAGGCAGG - Intergenic
1197558725 X:127991470-127991492 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1197757050 X:130002775-130002797 AAGAGTAAAGAGAGAGAGATGGG + Intronic
1197769169 X:130078974-130078996 AAGAAAAAAGAGTGAAAGGCAGG + Intronic
1198012613 X:132574093-132574115 CTGAAGATAGAGAGAGATGCAGG + Intergenic
1198074375 X:133180489-133180511 CAGAAGCAAGAGAGCAAGGCTGG - Intergenic
1198139866 X:133791856-133791878 GAAAAGAAAGAGAGAGAGGGAGG - Intronic
1198388336 X:136148333-136148355 CAGAATAAGGAGGGAGGGGGAGG + Intronic
1198801944 X:140457194-140457216 CAGGAAAAAAAGAGAGAGGGTGG - Intergenic
1198837495 X:140820175-140820197 GAGAAAAAAAAGAGAGAGACTGG + Intergenic
1198847881 X:140932127-140932149 CTGAATGGAGACAGAGAGGCTGG - Intergenic
1199241989 X:145557545-145557567 CAAAAGGAAGAGAGAGAGGAAGG - Intergenic
1199779990 X:151049695-151049717 CAAAAGAAAGAAAGAGAGACAGG + Intergenic
1199992579 X:152995865-152995887 CAGAAAAAAGAGAGAGAGAGAGG - Intergenic
1200635045 Y:5641511-5641533 CAGAAGAAAAAGAGAGAGATGGG + Intronic
1200656151 Y:5904031-5904053 TAGAAGCAAGAGAGAGAGGCAGG + Intergenic
1200725208 Y:6661614-6661636 GAGAACAAAGAGAGAGAAGAAGG - Intergenic
1200727028 Y:6684220-6684242 CAAGAGAAAGAGAGAGAGGGAGG - Intergenic
1200728180 Y:6699995-6700017 CAAGAGAAAGAGAGAGAGGGAGG - Intergenic
1201254425 Y:12092810-12092832 CAGAAAGAAGGGAGAGAGGGAGG + Intergenic
1201437360 Y:13973730-13973752 CAGGAGGAAGAGAGAGAGGGAGG + Intergenic
1201540104 Y:15096719-15096741 GAGAAAAAAGACAGAGAGGGAGG - Intergenic
1201547049 Y:15177149-15177171 GAGAAGAAAGGGAGAGAGGGAGG - Intergenic
1201622376 Y:15974244-15974266 CAGAGGAAAGAGGGAGAGGTAGG - Intergenic
1201724176 Y:17135510-17135532 GAGAGTAAAAAGAGAGAGGAAGG + Intergenic
1201724179 Y:17135546-17135568 CAGAGCAAAGAGAGAGAGAGAGG + Intergenic
1201741072 Y:17325299-17325321 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1201743236 Y:17345382-17345404 CAGTATAGAGAGTGAAAGGCTGG + Intergenic
1201887717 Y:18904040-18904062 GAGAAGAAATAGAGAGAGGAAGG + Intergenic
1202193287 Y:22267675-22267697 CAGAACAGAGAGAGAGAAACAGG - Intergenic