ID: 1097454669

View in Genome Browser
Species Human (GRCh38)
Location 12:59783173-59783195
Sequence TTTCATATGTAGAATGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097454665_1097454669 -8 Left 1097454665 12:59783158-59783180 CCTTTAAAAAATCCCTTTCATAT 0: 1
1: 0
2: 19
3: 398
4: 1192
Right 1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG 0: 1
1: 1
2: 3
3: 43
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097454669 Original CRISPR TTTCATATGTAGAATGTGGA AGG Exonic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
905196699 1:36284903-36284925 TTTCAAATGAAAAGTGTGGAAGG + Intronic
906300602 1:44678649-44678671 TTTCACATGTAGAATGAGACAGG - Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
910500235 1:87882191-87882213 TTTCATAGATAAAATGTGGCTGG + Intergenic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
911069053 1:93817722-93817744 TGTCATATGTAGTTTGTGCATGG - Intronic
911660205 1:100493124-100493146 TTTTATATTTAGAATTTTGAAGG + Intronic
912378572 1:109233374-109233396 TTTCGTATGTTGTATGTGAATGG + Intronic
912870325 1:113298462-113298484 TTTCACAGGTAAAATGTAGAAGG - Intergenic
913567581 1:120088292-120088314 TTTCAAATGTGGTATGTGGATGG - Intergenic
914288329 1:146248999-146249021 TTTCAAATGTGGTATGTGGATGG - Intergenic
914549366 1:148699745-148699767 TTTCAAATGTGGTATGTGGATGG - Intergenic
914617318 1:149371973-149371995 TTTCAAATGTGGTATGTGGATGG + Intergenic
914726326 1:150330663-150330685 TTTTTTATGGAGAATGGGGATGG + Intronic
914820929 1:151102413-151102435 TTTCATATATTGAATGTCAAAGG - Intronic
915992873 1:160533881-160533903 TTTTATATATAGTATGTGGTAGG + Intergenic
916459514 1:165008878-165008900 TGTCATTTGTGGAAAGTGGAAGG - Intergenic
916476357 1:165173204-165173226 GTCCATCTGTTGAATGTGGATGG + Intergenic
917495916 1:175540072-175540094 TCTCAGATGTAGAGTGGGGAGGG + Intronic
917576832 1:176331384-176331406 AATCATATGTAGAATTTGAATGG + Intergenic
918230462 1:182526309-182526331 TTTCATATCTAGAAACTAGAGGG - Intronic
918329695 1:183446539-183446561 TTTTATATATAGAATGTCCATGG - Intergenic
918393151 1:184087553-184087575 TTCTATGTGTAGAACGTGGAGGG + Intergenic
919235155 1:194831354-194831376 TTTTATATATAGTGTGTGGAAGG - Intergenic
919238182 1:194873679-194873701 TCTGATATGTAAAATCTGGATGG + Intergenic
919378697 1:196826955-196826977 TTTCATGTGTAGAACGGGGCTGG + Exonic
919388394 1:196950978-196951000 TTTCATGTGTAGAACGGGGCTGG + Exonic
920770324 1:208878612-208878634 TTTTATATTGAGAATGGGGAGGG - Intergenic
920911718 1:210224520-210224542 TTCCATATGTATAAAGTGAAGGG + Intergenic
921476033 1:215610772-215610794 TTTCATCTGTAAAATGGAGATGG + Intronic
922113720 1:222589226-222589248 TTTCATATGGGTAATGAGGAAGG - Intronic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
922632593 1:227131669-227131691 TTTCAGATGTAAACTTTGGAAGG - Intronic
923587170 1:235284031-235284053 TTTTAAATGTAGAATGAGGCTGG - Intronic
923796044 1:237156693-237156715 AGTAATATGTAGAATGTGGTGGG + Intronic
924582140 1:245331776-245331798 TTTCGTATGTAGAAAATGCAGGG + Intronic
1063575731 10:7260410-7260432 TGTCATATTTAGGGTGTGGAAGG - Intronic
1064138183 10:12768359-12768381 ATTCTTATGTAGAGTGTGAAAGG - Intronic
1064257209 10:13752740-13752762 TTTCATAAGTAGAGTGTTGCAGG + Intronic
1066180288 10:32955848-32955870 TCTCATGTGCAGAATGTTGAGGG + Intronic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1067688231 10:48480750-48480772 TCTCATCTGTAAAATGTGGTTGG - Intronic
1069097624 10:64278765-64278787 TTTCATATGTGTCATGTGTATGG + Intergenic
1069206408 10:65693141-65693163 TTTAATTTGTATAATGTGTAAGG + Intergenic
1069384042 10:67868301-67868323 TTTCACATATATAAAGTGGAGGG - Intergenic
1070330412 10:75412638-75412660 TTTCAAATGAGGAAGGTGGAGGG - Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071868889 10:89769779-89769801 TCTGGCATGTAGAATGTGGAAGG + Intronic
1072085537 10:92075936-92075958 TTTCTTGTGTACAGTGTGGAAGG - Intronic
1074913886 10:117937647-117937669 TCTCATCTGTAAAATGTTGATGG - Intergenic
1076097738 10:127745856-127745878 TTTCAGGTTTAGAATGTGTAAGG + Intergenic
1076296025 10:129385515-129385537 TTGGACATGTGGAATGTGGATGG + Intergenic
1076648063 10:131967436-131967458 TTACATTTGGAGAATGTGGATGG - Exonic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1079390286 11:20016345-20016367 TTTCAGATTTAGAATGGGAAGGG + Intronic
1080222863 11:29926625-29926647 TTTCATGCCTATAATGTGGAAGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083318452 11:61830214-61830236 TTTCATAGGTAAATTGTAGAAGG + Intronic
1084146584 11:67268131-67268153 TCTCATCTGTGAAATGTGGATGG + Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1085692688 11:78676546-78676568 TTGGATATGGAGAATCTGGATGG - Intronic
1086126103 11:83350192-83350214 TTTCTTATGAAGAATATGAAAGG - Intergenic
1086824531 11:91479428-91479450 TTTCATATGATTATTGTGGATGG - Intergenic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1087957581 11:104307855-104307877 TTAGAGATGTAGAATCTGGAAGG + Intergenic
1088202943 11:107359747-107359769 TTTCCTTTGTAAAATGTAGATGG - Intronic
1088455241 11:110026558-110026580 TTTCAACTGTAGAATGAGGGAGG - Intergenic
1089097879 11:115934617-115934639 TTTCCTAGGTAGAGTGTGGCTGG - Intergenic
1089436652 11:118474476-118474498 TTTGATAGGTAGAAAGTGGCAGG + Intronic
1089656785 11:119953429-119953451 TTTCATTTCTAGAATTTGGGGGG - Intergenic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1091056659 11:132425475-132425497 TTTTATGTATAAAATGTGGAAGG + Intronic
1091863547 12:3808947-3808969 TTTCATTTCTAGACTGTTGATGG - Exonic
1092954026 12:13532765-13532787 TTTCATAGGGAGAATGGGGAGGG + Intergenic
1093344143 12:18019607-18019629 TCTCATATATAGAATTAGGAAGG - Intergenic
1093792967 12:23276469-23276491 TTTCTTAGGAAGAATGTAGATGG + Intergenic
1094462251 12:30708993-30709015 TCTCAAATGTAAAATGTGAATGG - Intergenic
1095304453 12:40623264-40623286 ATTCAAATGTAGAATGTTAAAGG - Intergenic
1095321035 12:40827346-40827368 TTTCATTTCAAAAATGTGGAAGG - Intronic
1096160468 12:49372488-49372510 TTTCATGTATCCAATGTGGAAGG + Intronic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1098505360 12:71243148-71243170 TTTCACATGTAAAAAGAGGAGGG - Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1098887075 12:75971125-75971147 TTGCATATGTAGGAAGTGGTAGG - Intergenic
1099157169 12:79192549-79192571 GTTAATATCTACAATGTGGAGGG + Intronic
1099955152 12:89346066-89346088 TTTCTTCTGTGGAAGGTGGAAGG - Intergenic
1100207446 12:92366105-92366127 TTACAAATGTAGACTGTGGCAGG + Intergenic
1100226887 12:92566762-92566784 TTTCATAAGTAGAGTTTTGATGG - Intergenic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1101034495 12:100692026-100692048 ATTCATAACTAGAATGTGTAAGG - Intergenic
1101055565 12:100909104-100909126 TTAAATTTGAAGAATGTGGATGG + Intronic
1101681510 12:106971722-106971744 TTCCATATGTATAATGTGCCAGG + Exonic
1102725768 12:115063276-115063298 TTTTATTTGTAAAATGGGGATGG + Intergenic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1103661345 12:122521127-122521149 TTTCATATGAAGAATATGATTGG - Intronic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106808072 13:33332015-33332037 TTTATGATGTAAAATGTGGAAGG - Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1110300590 13:73922223-73922245 ATTCATATGTAAAATGTTTAAGG - Intronic
1110309218 13:74027804-74027826 TTTTATGTGAAGAATGTGTATGG - Intronic
1110460464 13:75739366-75739388 TTTCAGGAGTAGAATGTGTAAGG + Intronic
1110585670 13:77188520-77188542 CTTCATGTGTACAATGGGGATGG + Intronic
1111319835 13:86612774-86612796 TTTAATATGCAGAATGTATAAGG - Intergenic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1112944708 13:104914084-104914106 CTTCATTTGGAGAATGCGGATGG - Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1115008510 14:28515859-28515881 TTTGATATGCAGAATTAGGAAGG + Intergenic
1115505547 14:34090479-34090501 TTTCATTTGTAAAGTGTTGAGGG + Intronic
1116109210 14:40554484-40554506 TTACGTAGGTAGAATATGGAAGG + Intergenic
1116405303 14:44559117-44559139 TTTAAAATGTAAAATGTGGCCGG + Intergenic
1116811885 14:49547325-49547347 TTTAATATGTGGATGGTGGAGGG - Intergenic
1116858790 14:49977436-49977458 CTTCATATGTCGAATCTGAAAGG + Intergenic
1117534038 14:56687189-56687211 TTTCATTTGTAGATTATGGATGG + Intronic
1117572241 14:57058908-57058930 TTTCATCTGTAAAATGGGCATGG - Intergenic
1118129861 14:62950821-62950843 TTTCATAAGTAGAATATAAATGG + Intronic
1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG + Intronic
1118537533 14:66784573-66784595 AATCATATTTAAAATGTGGAAGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1119461881 14:74812085-74812107 TTACATATGAAAAATGTGTATGG - Intronic
1119526971 14:75330580-75330602 TTTCATATGGAGACTTGGGATGG + Intergenic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1119574389 14:75705578-75705600 TTTAATCTATAAAATGTGGATGG + Intronic
1120115985 14:80617973-80617995 TTTCATCTATAAAATGGGGATGG + Intronic
1120256526 14:82126727-82126749 CTTCATCTGTATAATGTGAATGG - Intergenic
1121075359 14:91063609-91063631 CTTCATATGTGTAATATGGAGGG + Intronic
1121916198 14:97838649-97838671 TTTCATTTGTAAAATGATGAAGG + Intergenic
1124828197 15:33121064-33121086 TTTCATCTGTCCCATGTGGAAGG - Intronic
1126980173 15:54232908-54232930 TTTGATGTTTTGAATGTGGAAGG + Intronic
1127250986 15:57237938-57237960 TTTCATAAAAAGAATGTGTATGG - Intronic
1132245146 15:100289833-100289855 TTCAATATGTAGTTTGTGGAGGG - Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133616453 16:7481122-7481144 TTTCATTTGTTCAATGAGGATGG + Intronic
1134201143 16:12200122-12200144 TTTCATCTGTACAATGAGGTTGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134784356 16:16927606-16927628 TTTCATCAGTAAAATGTGGATGG + Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1138986780 16:62338588-62338610 CTTCATAAGTAGAATGTGTAGGG - Intergenic
1139028778 16:62853401-62853423 TTACATATGAAGAATGTGCCAGG + Intergenic
1140589907 16:76339285-76339307 TGTTATATGTTGAATGGGGAGGG - Intronic
1140620523 16:76725546-76725568 TTTCATATTTAAAATGTTCAAGG + Intergenic
1142732839 17:1873396-1873418 TTGGATTTGTAGAATGTGGTTGG + Intronic
1142839608 17:2617338-2617360 TTTCCTATGTAAATTTTGGATGG + Intronic
1143232781 17:5371508-5371530 TTTCATATCCAGAAGGTGGTGGG + Intronic
1143952139 17:10641684-10641706 TTTCATATGTTTAATGGAGACGG + Intronic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144889811 17:18488160-18488182 TGTCATCTGTAGAATGAGCATGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1146472275 17:33134191-33134213 TCTTATATGTAAAATGGGGATGG - Intronic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1146938716 17:36828611-36828633 TTCCAGAGTTAGAATGTGGATGG - Intergenic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1149820983 17:59777353-59777375 TTTTATACTTAGAATTTGGAAGG + Intronic
1150322541 17:64227782-64227804 TTTCATCTGTAAAATGGGAATGG + Intronic
1153517672 18:5919425-5919447 TTTCATCTGCAGAATATTGAAGG - Intergenic
1157156180 18:45268712-45268734 TTTCATCTGTTGAATGGAGAAGG + Intronic
1158123132 18:54072358-54072380 TGTCATTTGTAGAATATGAATGG - Intergenic
1158683778 18:59594221-59594243 ATTCATTTGTAGAAGGAGGACGG - Intronic
1158836691 18:61337267-61337289 TATCCGAAGTAGAATGTGGAGGG - Intronic
1159237340 18:65693498-65693520 TTGCATATGGAGAATGTTGTTGG - Intergenic
1159863715 18:73680542-73680564 TTTCATCTGTAAAATGAGCATGG - Intergenic
1164190604 19:22913760-22913782 TTAAAGATGTAGAAGGTGGAAGG - Intergenic
1164369315 19:27628907-27628929 CTTCTTATGTAGAATCTGCAAGG + Intergenic
1165280206 19:34790815-34790837 ATACATATTTACAATGTGGATGG - Intergenic
1165359593 19:35327913-35327935 CTTCATCTGTAGGATGTGCATGG + Intronic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
925444859 2:3919035-3919057 TTTCATATGTATTTTGGGGAGGG - Intergenic
925558188 2:5155087-5155109 TTTCTTATTTAGACTGTGCAAGG - Intergenic
925839088 2:7974238-7974260 TTTCCTAAGAAGAATGTGCAAGG + Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926548967 2:14277897-14277919 TGTAATATGCAGAATGTGTAAGG - Intergenic
926927152 2:17998646-17998668 TTTTATATGCAAAATGTGTAAGG + Intronic
927056035 2:19366242-19366264 TTGCATATGTGGAAAGAGGAGGG + Intergenic
927078210 2:19601449-19601471 TTTCTCATGATGAATGTGGATGG + Intergenic
927154723 2:20214946-20214968 TCTCATCTGTAAAATGTGCATGG - Intronic
927608608 2:24513274-24513296 TTTCCTCTGGGGAATGTGGAAGG - Intronic
927935914 2:27076481-27076503 TTTGCAATGTAGAATTTGGAAGG + Intergenic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928678111 2:33670451-33670473 TTTCCTAAGTAGATTGTGGTTGG + Intergenic
928883715 2:36125408-36125430 ATTCCTTTGTAGAATGTGAATGG - Intergenic
928914800 2:36459312-36459334 TTTCAAAATTAGTATGTGGAAGG - Intronic
928938024 2:36700869-36700891 TTTCATCTGTATAATGGTGATGG - Intronic
928942689 2:36742538-36742560 TGTTCTATGTAGGATGTGGAAGG - Intronic
929063067 2:37943048-37943070 TTTCATGGGTGGCATGTGGATGG - Intronic
929923473 2:46190478-46190500 TTTCTCATCTAGAATGTGGTTGG - Intergenic
930498046 2:52174004-52174026 TATCATATATAGACTGTAGAAGG - Intergenic
930765989 2:55085692-55085714 TTTTCTATGTAGATTGGGGAAGG - Intronic
931228467 2:60353634-60353656 TTACATGTGTGGAATGTGGCTGG - Intergenic
933316090 2:80717140-80717162 TTTCAGGTGGAGAATATGGAGGG - Intergenic
933832077 2:86219114-86219136 TTTCAGTTGTAGGATGTGGATGG - Intronic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935713898 2:105922911-105922933 TTTTATTAATAGAATGTGGAGGG - Intergenic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
936505483 2:113102411-113102433 TTTGATATGTGGATTGTGGAGGG + Intergenic
936583728 2:113731893-113731915 TTTCACATGTAAAATGGGAATGG - Intronic
938873972 2:135513529-135513551 TTTCATATGCAGCATGAGGTGGG - Intronic
938906834 2:135845088-135845110 TTTCCTCTGTAGAAAGGGGAAGG + Intronic
938918325 2:135967390-135967412 TTTTATACGTACCATGTGGAAGG - Intronic
939181573 2:138809186-138809208 TAGCATTTTTAGAATGTGGAGGG + Intergenic
939456119 2:142437936-142437958 TTTGAGTAGTAGAATGTGGATGG - Intergenic
939679510 2:145112904-145112926 CTTCATTTGTAAAATGTGGTTGG + Intergenic
939999697 2:148954637-148954659 GTTTGTATGTTGAATGTGGAAGG + Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
943405650 2:187480434-187480456 TTTCCAATGTAAAATGAGGATGG - Intronic
944258787 2:197653761-197653783 TTTCTTATGGAAAAAGTGGATGG - Intronic
944892467 2:204131553-204131575 TTTCATATCTAGCATTTTGATGG + Intergenic
944915896 2:204359867-204359889 TTTCAAATGTACAATTTGCATGG + Intergenic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945016142 2:205519074-205519096 TTTCTTATGTAGAATCTTGCAGG + Intronic
945779488 2:214151883-214151905 TTTCATATAAGGAATGTGGGTGG + Intronic
1169399262 20:5265871-5265893 GTTCACATGTAGGATGTAGACGG + Intergenic
1169799557 20:9500879-9500901 TTTCAAATGTTAAATGTGGGAGG - Intergenic
1170651903 20:18250737-18250759 TTTCATATGTAAAAAGAGTAGGG + Intergenic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174086440 20:48011629-48011651 TTTTATATGTTCAAAGTGGATGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1176946861 21:14992341-14992363 TTTCAGATGTAGACTCTGCAGGG - Intronic
1177470011 21:21548439-21548461 TTTGTTATGTAGACAGTGGAGGG - Intergenic
1177552500 21:22643869-22643891 TCTCAGATTTAGTATGTGGATGG - Intergenic
1179548806 21:42130046-42130068 TTTCATCTGTAGCATGGGTATGG - Intronic
1180911084 22:19450824-19450846 TTTCTTATGAGTAATGTGGATGG - Intronic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1184306677 22:43607670-43607692 TTTCATCTGTTCAAAGTGGAAGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
950106629 3:10392810-10392832 TGTCATCTGTAGAGTGGGGAGGG + Intronic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
951615759 3:24541875-24541897 TTTCATATCTAGAAGGTGACAGG - Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952032035 3:29154908-29154930 TTTCCTAGGGAGAATGTGGTTGG + Intergenic
952282336 3:31935834-31935856 TTTCATATGTAGAAAGGGAAAGG + Intronic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
953260907 3:41338319-41338341 TTTCACAGTTAGAATGTTGAGGG - Intronic
953889213 3:46738186-46738208 TTTAATAAGTAGTATGTGGATGG - Intronic
954428690 3:50457727-50457749 CTTCATATATAAAAGGTGGAGGG - Intronic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955991665 3:64634254-64634276 TTTAAAATGTAGAAGGTGAAAGG + Intronic
956699067 3:71942787-71942809 TCTCATGTGTGAAATGTGGATGG + Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
958161064 3:89817689-89817711 TTTCATACCTAGTTTGTGGAAGG - Intergenic
959194313 3:103158841-103158863 TTTCATAAGAAGACTGTGAAGGG + Intergenic
960099412 3:113724496-113724518 TTTCATGAATAGAATGTGCATGG - Intronic
960233162 3:115252780-115252802 TAGCACATGTAGAAAGTGGAAGG + Intergenic
961559967 3:127721960-127721982 TTACATATTTAAAAGGTGGAAGG + Intronic
962505151 3:136039218-136039240 TTTCCTCTGTAGAATGATGAGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963359130 3:144248115-144248137 TTTCATATATAAAATGAGAAGGG - Intergenic
963523515 3:146386720-146386742 TTATATATGTAGAAAGTGGGTGG + Intergenic
963616479 3:147544939-147544961 TTTCATAAGAAGAATGCAGATGG + Intergenic
966012129 3:175092649-175092671 TATCATATGTTGAATATAGATGG + Intronic
966649496 3:182283454-182283476 TTTTATTTGTAGAATGAAGAAGG + Intergenic
967726292 3:192865383-192865405 TTTCATAGGAAGCATGTAGAAGG + Intronic
969478234 4:7433234-7433256 TTTCATTTGTGAAATGGGGATGG + Exonic
970181407 4:13399944-13399966 TTTTCTACTTAGAATGTGGAAGG - Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972897996 4:43646400-43646422 TTCCATATGTAAAATTTAGAAGG - Intergenic
972961272 4:44455123-44455145 TTATAAATGTAGAATGTGGATGG + Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
975972317 4:80055215-80055237 TTGCCTATGGAGAATGAGGAGGG + Exonic
976981422 4:91236173-91236195 TTTTATATGTACAATGAGGCTGG - Intronic
977089630 4:92653974-92653996 CTTCATATGTGGAAAGAGGATGG + Intronic
977238125 4:94533467-94533489 TTTAATATGTAGAATTTTTAAGG + Intronic
977611932 4:99044495-99044517 TATTATATGTAGAATGTGTGAGG + Intronic
977636204 4:99301522-99301544 CTTCATCTGTACAATGTGCATGG - Intergenic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
978835482 4:113144585-113144607 TTTAATTTATAGCATGTGGATGG + Intronic
980304084 4:131034034-131034056 TTTCAAATGTTGAAAGTTGATGG - Intergenic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
984006774 4:174320833-174320855 TTTAATATGGAGAATGGGTAAGG + Intronic
984210652 4:176843424-176843446 TTTCAAATATTAAATGTGGAGGG - Intergenic
985052157 4:186001688-186001710 TTTGAAATGTGGAATGTTGAAGG - Intergenic
985343784 4:188979748-188979770 TTTTTTATGTATAATGTTGATGG + Intergenic
986291492 5:6403181-6403203 TTTCATATGTAATTTGAGGAAGG - Intergenic
987293418 5:16529161-16529183 TTGCATTTGTAGATTTTGGAAGG - Intronic
987465931 5:18271857-18271879 CTTCATATGTAGAAAGTTGGAGG - Intergenic
988422317 5:31021599-31021621 TTTCTTATGTCTAATGTGCAAGG + Intergenic
989501073 5:42168678-42168700 TTACATGTGTATAATGTAGATGG + Intergenic
990254583 5:53953605-53953627 TTTCATATGAAGAGGGTGGAGGG + Intronic
991488320 5:67160779-67160801 TTACATATTTACATTGTGGAAGG + Intronic
992568039 5:78022129-78022151 TTCCATATGTGGATTGTTGAAGG + Intronic
993097794 5:83500489-83500511 TTTCATGAGTAGAATGAGGAAGG + Intronic
993153612 5:84192959-84192981 TTTCATTTGTAGGATGTAGAAGG + Intronic
993416774 5:87643192-87643214 TTTCATATGAAGGATCTAGAAGG - Intergenic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
997025765 5:130059104-130059126 TATCTTCTGTAAAATGTGGATGG + Intronic
997778995 5:136638348-136638370 TTTCATCTGTAGACTGGAGATGG - Intergenic
999271671 5:150300270-150300292 TATCATCTGTAGAATGGGGGTGG - Intronic
999627902 5:153539579-153539601 GTACATATGTAGAATGAGGTTGG + Intronic
1000596681 5:163222665-163222687 TTTCATATAAATAATGTGTAAGG + Intergenic
1000641998 5:163713664-163713686 TTTCATAATGAGAATGTTGAAGG - Intergenic
1000644595 5:163745525-163745547 TCTAATATCTAGAATGTGTAAGG - Intergenic
1000758383 5:165189432-165189454 TTGTATATGTAGAACGTGGCTGG + Intergenic
1001529457 5:172452159-172452181 TTTCATCTGTGTAATGGGGATGG - Intronic
1001914077 5:175544924-175544946 TTGCATATGTAGAATGAGAATGG + Intergenic
1002460570 5:179371510-179371532 TTTCATCTGTAACATGAGGATGG - Intergenic
1003848511 6:10198383-10198405 TTTCAAATGGAGAAAGTGGGTGG - Intronic
1004897168 6:20159716-20159738 ATACATATGTATATTGTGGAAGG - Intronic
1005263097 6:24082744-24082766 TCACATATGTAGCTTGTGGATGG + Intergenic
1005443013 6:25891646-25891668 TTGCATATGTAGAATGAAGGAGG - Intergenic
1005995619 6:30929466-30929488 TTTCATATGGAGATAATGGAGGG + Intergenic
1006255795 6:32830934-32830956 TTTTAAATGTACAATTTGGACGG + Intronic
1006622417 6:35375054-35375076 TTTCATAAACAGAATGTGGCTGG + Intronic
1007256592 6:40534025-40534047 TTTCTCATGTAGAAAGTGGAAGG - Intronic
1007757275 6:44108055-44108077 TCTCATATGTGAAATGTGGTTGG + Intergenic
1008267371 6:49445085-49445107 TTTCATATGAAGTATTTTGAAGG + Intronic
1009385283 6:63079511-63079533 TTGCATATTTAGAAGTTGGAAGG + Intergenic
1010715649 6:79226347-79226369 TCTCATATGTAAAATGAGAACGG + Intronic
1010831098 6:80530519-80530541 TCTCATCTGTAAAATCTGGAAGG - Intergenic
1012109549 6:95211742-95211764 TTGCATATGTAAAATTTTGAGGG - Intergenic
1012784536 6:103606629-103606651 TTTCATATATAAAATGAGGATGG + Intergenic
1013497848 6:110716835-110716857 TTTAATAAATAGAATGTGGCAGG + Intronic
1013828178 6:114240435-114240457 TGTCAGATGTAGTATGTGAAAGG + Intronic
1014350456 6:120336982-120337004 TATCATTTGTAGAATCTGTATGG - Intergenic
1015000577 6:128209542-128209564 TTTAATGTGTAGAATGAGGAGGG - Intronic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG + Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1015685763 6:135857807-135857829 TTTCAGATGTATTAAGTGGAGGG + Intronic
1016612150 6:146002133-146002155 TGACATATATAAAATGTGGAAGG + Intergenic
1017377089 6:153783690-153783712 TTACACATGTAGAAGTTGGAGGG - Intergenic
1019495251 7:1335384-1335406 TTTTAAACGTAGAATCTGGAGGG - Intergenic
1021018565 7:15566983-15567005 TTTCATATTCAAATTGTGGAAGG - Intergenic
1021789204 7:24184225-24184247 TTTCAAATGTTGAATGAGCATGG - Intergenic
1023308148 7:38853121-38853143 TTTCATAAGAAGAATGTGGCCGG + Intronic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024499687 7:50091688-50091710 TTTAATATTTACAATGTGCAAGG - Intronic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1027982636 7:85245575-85245597 TTTCATGTGTATACTGAGGATGG - Intergenic
1028006635 7:85579113-85579135 TTGCATATGTAAACTGTGAAGGG - Intergenic
1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG + Intronic
1029015129 7:97308371-97308393 TTTTACATGTAGAAGGTAGAAGG - Intergenic
1031009771 7:116513849-116513871 TTTCACATGTTGTATGTGCAGGG + Intergenic
1031492605 7:122407499-122407521 TTTCATATGTGAAATGGGGAGGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1032895177 7:136242260-136242282 TTTCAAATGGAAAATGTGAAAGG + Intergenic
1033457582 7:141516636-141516658 TTAGATATGTAGAAAGTGAAAGG + Intergenic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1035814519 8:2524939-2524961 GATCATATGAAGAATGTGTAAGG - Intergenic
1037326696 8:17698981-17699003 TTTAGTATGTAGAATCTGGAAGG - Intronic
1037590313 8:20306420-20306442 TTTCCTATCTGGAAAGTGGATGG + Intergenic
1038955787 8:32467100-32467122 TTTCAGATATAGAATTTGCAAGG + Intronic
1040963540 8:53061226-53061248 TTTCATATGCTAAATGTGTAAGG - Intergenic
1041696045 8:60737466-60737488 TTTCATCTGTTAAATGAGGAGGG + Intronic
1042587588 8:70358579-70358601 TTTTATATATAGAATGAGGTGGG - Intronic
1043272963 8:78356875-78356897 TATCATAGCTAGAATGTGTAGGG + Intergenic
1044854862 8:96465516-96465538 TTTCAGAATTAGAATGTGGTTGG + Intergenic
1045189475 8:99868779-99868801 TTTCCTATGATAAATGTGGAAGG + Intronic
1045256361 8:100526979-100527001 CTTCACACGTATAATGTGGAAGG + Intronic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1046852155 8:118986869-118986891 TTTCAGGTATAGGATGTGGAAGG + Intergenic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1049005664 8:139854099-139854121 TTTCTCCTGTAGAATGTTGAAGG - Intronic
1050649567 9:7760736-7760758 CTACATCTGTAGTATGTGGAAGG + Intergenic
1051843032 9:21419782-21419804 TTTCCTATGTAAAGTATGGAGGG + Intronic
1055032875 9:71788381-71788403 TTTCTTATCTAGGATGTGCAAGG + Intronic
1055098138 9:72435501-72435523 TTTCATATTTTAAATGTGGAAGG - Intergenic
1055218223 9:73894083-73894105 TTCCATTTGTAGAATCTAGATGG - Intergenic
1055319631 9:75069750-75069772 TTCCATATGAAGAATGTAAAAGG - Exonic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056222157 9:84460697-84460719 GTTCATATGTTTAATGTGGATGG + Intergenic
1056225283 9:84489236-84489258 TTTTAGATGTAGTATGGGGAAGG + Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057515092 9:95714137-95714159 TTTCGTGTGTAGAATGTCTATGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059148339 9:111922330-111922352 TTTCATGTGATGAATTTGGAAGG + Intronic
1059243954 9:112833824-112833846 TTTCTTGTCTAGAATGTGGGAGG + Intronic
1059814285 9:117894127-117894149 TATAATATGTAGAATATGAATGG - Intergenic
1059993291 9:119885419-119885441 TCTCATTTGTAGAATGAGGGGGG - Intergenic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060392756 9:123291901-123291923 TCTCATCTGTAAAATGTGCAGGG - Intergenic
1203536071 Un_KI270743v1:41060-41082 TTTCATAGGAATAATGTTGAAGG + Intergenic
1185688733 X:2135192-2135214 TTTCATATGTAATATGTCCATGG + Intergenic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1187397359 X:18930372-18930394 TGTCATTTGTAGAAAGTGCAAGG - Intronic
1187603386 X:20858183-20858205 TGTGATACGTAGACTGTGGATGG + Intergenic
1188909176 X:35824296-35824318 TGTCTTTTGTAGAATATGGATGG - Intergenic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1189954746 X:46265926-46265948 TTTCACATTTAGAATGAAGAGGG - Intergenic
1193061984 X:77216387-77216409 TTTCAAATATAAATTGTGGAGGG + Intergenic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1194003689 X:88464182-88464204 ATTTATATGTAGATTGTGAAAGG + Intergenic
1194697144 X:97067081-97067103 TGTAATATGTAGCATGTGCAAGG + Intronic
1194878272 X:99217788-99217810 TTTAATTTTTAGAATGTGTAGGG + Intergenic
1196346994 X:114674545-114674567 TTTCATATTTACAATTTGGGAGG - Intronic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1197315765 X:124964200-124964222 TTTCAAATGTGGAATGTGCAGGG - Intergenic
1197464564 X:126786558-126786580 TTTCATTTGTTAAATGGGGATGG + Intergenic
1197855919 X:130913933-130913955 TTTCATTTGTAAAATTTCGATGG - Intergenic
1198634925 X:138686973-138686995 TTGTATATGTTGAATGTGGTAGG - Intronic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1200336094 X:155353110-155353132 TTTCATTTGTAAAATGGAGATGG - Intergenic
1200350376 X:155488117-155488139 TTTCATTTGTAAAATGGAGATGG + Intergenic
1201699220 Y:16861602-16861624 TTACATATGTTGAAAGTAGATGG + Intergenic