ID: 1097461847

View in Genome Browser
Species Human (GRCh38)
Location 12:59872045-59872067
Sequence CCTCATTAGATCCTGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097461835_1097461847 28 Left 1097461835 12:59871994-59872016 CCCAGGCTCCAGGGTGTAGACCT No data
Right 1097461847 12:59872045-59872067 CCTCATTAGATCCTGGTGCCAGG No data
1097461841_1097461847 2 Left 1097461841 12:59872020-59872042 CCAGCAGACGCAGGGTCCAGACC No data
Right 1097461847 12:59872045-59872067 CCTCATTAGATCCTGGTGCCAGG No data
1097461836_1097461847 27 Left 1097461836 12:59871995-59872017 CCAGGCTCCAGGGTGTAGACCTA No data
Right 1097461847 12:59872045-59872067 CCTCATTAGATCCTGGTGCCAGG No data
1097461840_1097461847 8 Left 1097461840 12:59872014-59872036 CCTACTCCAGCAGACGCAGGGTC No data
Right 1097461847 12:59872045-59872067 CCTCATTAGATCCTGGTGCCAGG No data
1097461837_1097461847 20 Left 1097461837 12:59872002-59872024 CCAGGGTGTAGACCTACTCCAGC No data
Right 1097461847 12:59872045-59872067 CCTCATTAGATCCTGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097461847 Original CRISPR CCTCATTAGATCCTGGTGCC AGG Intergenic
No off target data available for this crispr