ID: 1097473287

View in Genome Browser
Species Human (GRCh38)
Location 12:60021915-60021937
Sequence AAGCCCCCATTCCAAGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097473287_1097473290 10 Left 1097473287 12:60021915-60021937 CCTAGGGCTTGGAATGGGGGCTT No data
Right 1097473290 12:60021948-60021970 ACCAGTGCCCTAACCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097473287 Original CRISPR AAGCCCCCATTCCAAGCCCT AGG (reversed) Intergenic
No off target data available for this crispr