ID: 1097475158 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:60045591-60045613 |
| Sequence | ATAATCCAGCAATCCCACTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1097475158_1097475160 | 11 | Left | 1097475158 | 12:60045591-60045613 | CCAAAGTGGGATTGCTGGATTAT | No data | ||
| Right | 1097475160 | 12:60045625-60045647 | TTTTTTTTTTTTTTTTTTTGAGG | 0: 5644 1: 19016 2: 22217 3: 49735 4: 178307 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1097475158 | Original CRISPR | ATAATCCAGCAATCCCACTT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||