ID: 1097475158

View in Genome Browser
Species Human (GRCh38)
Location 12:60045591-60045613
Sequence ATAATCCAGCAATCCCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097475158_1097475160 11 Left 1097475158 12:60045591-60045613 CCAAAGTGGGATTGCTGGATTAT No data
Right 1097475160 12:60045625-60045647 TTTTTTTTTTTTTTTTTTTGAGG 0: 5644
1: 19016
2: 22217
3: 49735
4: 178307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097475158 Original CRISPR ATAATCCAGCAATCCCACTT TGG (reversed) Intergenic
No off target data available for this crispr