ID: 1097478783

View in Genome Browser
Species Human (GRCh38)
Location 12:60094164-60094186
Sequence TAGATTATACAGATTGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097478782_1097478783 5 Left 1097478782 12:60094136-60094158 CCTTTGAATGGGGTATGATGGAA No data
Right 1097478783 12:60094164-60094186 TAGATTATACAGATTGACAAAGG No data
1097478777_1097478783 27 Left 1097478777 12:60094114-60094136 CCAAGGTCACGTCACATTGGTAC No data
Right 1097478783 12:60094164-60094186 TAGATTATACAGATTGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097478783 Original CRISPR TAGATTATACAGATTGACAA AGG Intergenic
No off target data available for this crispr