ID: 1097481367

View in Genome Browser
Species Human (GRCh38)
Location 12:60129899-60129921
Sequence AACTCCTTGCAGACGTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097481367_1097481368 10 Left 1097481367 12:60129899-60129921 CCTTTAGACGTCTGCAAGGAGTT No data
Right 1097481368 12:60129932-60129954 TATGAAATCTTTTACTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097481367 Original CRISPR AACTCCTTGCAGACGTCTAA AGG (reversed) Intergenic
No off target data available for this crispr