ID: 1097486060

View in Genome Browser
Species Human (GRCh38)
Location 12:60202691-60202713
Sequence AAGCTGAGCAGAATATAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097486060_1097486062 -2 Left 1097486060 12:60202691-60202713 CCTGTCTATATTCTGCTCAGCTT No data
Right 1097486062 12:60202712-60202734 TTGGACAATTTGCTCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097486060 Original CRISPR AAGCTGAGCAGAATATAGAC AGG (reversed) Intergenic
No off target data available for this crispr