ID: 1097487076

View in Genome Browser
Species Human (GRCh38)
Location 12:60216325-60216347
Sequence GGAGTCTCTCACATTGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097487076 Original CRISPR GGAGTCTCTCACATTGATAA TGG Intergenic
900925078 1:5699988-5700010 GGATTCCCTCAATTTGATAAAGG + Intergenic
902686463 1:18080687-18080709 GGAGCCTCTGACATTTATGAGGG - Intergenic
907733859 1:57092765-57092787 GAAGTCTCTGACAGTTATAAGGG + Intronic
909552008 1:76908364-76908386 GGAGCCTCTTTCATTCATAAGGG + Intronic
909666424 1:78138877-78138899 GGAGTCTCTAGAAGTGATAAAGG - Intergenic
909778588 1:79514870-79514892 AGACTCTCACACATTAATAATGG - Intergenic
910222870 1:84906260-84906282 GGAGTCTCATACATTGTCAATGG + Intergenic
912816906 1:112836416-112836438 GAATTCTCACACATTGCTAATGG + Intergenic
915872135 1:159572565-159572587 AGAGTCCCACACATTAATAATGG - Intergenic
916075943 1:161200052-161200074 GGATTCTCCCAGATTGATACTGG - Intronic
916815877 1:168352479-168352501 GGACTCCCACACATTAATAATGG - Intergenic
917779583 1:178378796-178378818 GTAGTCTTTTACATTGAAAAGGG + Intronic
921702123 1:218280624-218280646 GGAGTTTCTCACTTTGGGAAAGG - Intergenic
921971296 1:221152142-221152164 GGAGTCACTCATATTGTTAGAGG + Intergenic
922625519 1:227037301-227037323 TGAGTCTCTTACATAGTTAAGGG - Intronic
1063499833 10:6543548-6543570 AGCGTCTCTCTAATTGATAAGGG - Intronic
1067927239 10:50522258-50522280 GGAGTATGTCACAGGGATAAAGG - Intronic
1068202137 10:53795960-53795982 AGACTCTCACACATTAATAATGG - Intergenic
1076351917 10:129822099-129822121 GAAGTCTCACACATTGCTAGTGG - Intergenic
1079159007 11:17975335-17975357 GGGGTCACTCACATTTATCAAGG - Intronic
1079506985 11:21163920-21163942 GCAGTCTCTAACATTCATAAGGG + Intronic
1080374017 11:31686511-31686533 GGATTCTCTCCCATGGGTAATGG + Intronic
1081952083 11:47053136-47053158 GGAATCATTCACATGGATAAAGG + Intronic
1083450529 11:62741656-62741678 GGAGTCTAGCCCATTGAGAAAGG - Intergenic
1086356281 11:86004001-86004023 GGAGTTTATCACCTTGAAAATGG + Intronic
1088315760 11:108504809-108504831 GGAGATTCACACATTTATAAAGG - Intergenic
1091610370 12:2002567-2002589 GGTATCTATCACATTGATAAGGG + Intronic
1097487076 12:60216325-60216347 GGAGTCTCTCACATTGATAATGG + Intergenic
1100439672 12:94605004-94605026 GGAGTGTCTAAAATTGAGAATGG + Intronic
1104052702 12:125206812-125206834 CAAGTTTCTCACATTGATGAAGG - Intronic
1106173247 13:27307304-27307326 GGACTCACTCACATTGAGACTGG + Intergenic
1108607707 13:52056326-52056348 AGACTCTCACACATTAATAATGG + Intronic
1109096692 13:58127937-58127959 GCTGTCTGTCACATTGAAAATGG - Intergenic
1111028500 13:82566921-82566943 GGAGTCAGTCACATTGATGCAGG + Intergenic
1111374931 13:87366345-87366367 AGACTCTCACACATTAATAATGG - Intergenic
1112386661 13:98946290-98946312 GGAGTCTCTCGCATTAATCCAGG + Intronic
1115162874 14:30415349-30415371 GGAGTTTGTCAGGTTGATAAGGG - Intergenic
1115168524 14:30476425-30476447 AGACTCCCACACATTGATAATGG + Intergenic
1117222794 14:53622360-53622382 GGACTCTCTCACAATCCTAAAGG + Intergenic
1117376018 14:55118866-55118888 AGAGTCTCTAATATTGCTAAAGG + Intergenic
1123164823 14:106316075-106316097 GGAGTCTCTCTCTTTGAACATGG - Intergenic
1123200111 14:106655392-106655414 TGAGGTTCTCACATTGTTAAAGG - Intergenic
1124808540 15:32910513-32910535 GGAGTCATCCACATTGAAAATGG + Exonic
1125228982 15:37429544-37429566 AGAGTCCCACACATTAATAATGG + Intergenic
1126005694 15:44254413-44254435 AGACTCTCACACATTAATAATGG + Intergenic
1126568176 15:50122385-50122407 TAAGTCTCTGACATTGAGAATGG + Intronic
1131955733 15:97733873-97733895 GGAGTCTCTCATTTTGAGAGAGG - Intergenic
1134906084 16:17981027-17981049 GAAGTTTCTCACATTCAAAATGG + Intergenic
1135945502 16:26861303-26861325 GGAGTTCATCACATTGACAAGGG - Intergenic
1137751764 16:50867352-50867374 GAAGTCCCACACATTGATAGTGG - Intergenic
1138097606 16:54224328-54224350 GGAATCTCACACACTGATGATGG + Intergenic
1140755014 16:78059137-78059159 GGAGCCTCTCTCCCTGATAAGGG + Intronic
1140939561 16:79708571-79708593 TGAGTCTCTCACATAGGCAATGG + Intergenic
1146586425 17:34086651-34086673 AGAGTCCCACACATTAATAATGG - Intronic
1149587887 17:57805325-57805347 GGACTCTCATACATTGTTAATGG - Intergenic
1149771336 17:59324137-59324159 CAACTCTCTAACATTGATAATGG - Intergenic
1156235175 18:35196181-35196203 GGAGGCTATCAGATTGATGATGG - Intergenic
1157066293 18:44354800-44354822 GGAATCTCTCACAATAATAGCGG - Intergenic
1157436957 18:47678524-47678546 AGAGTCTCTCCCATTGGCAAAGG + Intergenic
1163466527 19:17471097-17471119 GAAGTCTCTCACAGTTATCACGG - Intronic
1163916506 19:20245113-20245135 GGGGTCTCTCATCTCGATAAGGG - Intergenic
1163966867 19:20754125-20754147 GGAGCCTCTCTCCCTGATAAGGG + Intronic
926425650 2:12736472-12736494 GGAATCTCCCATAGTGATAAGGG - Intronic
928253335 2:29700918-29700940 GGAGTCTCACACATTCCTAGAGG - Intronic
928637669 2:33264743-33264765 AGACTCTCTCACATTGCTAAAGG + Intronic
928990386 2:37227002-37227024 GGAGGCGCTCACATTCATATTGG - Intronic
936932699 2:117806176-117806198 AGACTCTCACACATTAATAATGG + Intergenic
939378034 2:141396394-141396416 TCAGTTTCTCACATTGTTAATGG + Intronic
943359394 2:186899691-186899713 AGACTCCCTCACATTAATAATGG - Intergenic
945361084 2:208896442-208896464 GGACTCCCACACATTAATAATGG + Intergenic
945688102 2:212997454-212997476 CGAATTTCTCACATTGAAAAAGG + Intergenic
946768551 2:223063225-223063247 GGAGCCTCTCACATAGACACAGG + Intronic
1169543382 20:6625852-6625874 GAACTCTCACACATTGCTAATGG + Intergenic
1169591110 20:7143695-7143717 GGAGGCTCTTACAGTGATATAGG - Intergenic
1169657404 20:7940695-7940717 GGTGTCTATCACATTAAAAAGGG + Intergenic
1173025009 20:39299343-39299365 GGAATCTGTCACATGGGTAATGG - Intergenic
1175622460 20:60460401-60460423 GAACTCTCTCAACTTGATAAAGG + Intergenic
952028215 3:29109719-29109741 AGAGTCCCACACATTAATAATGG - Intergenic
953757569 3:45660439-45660461 GGAGTCTCTCTCTGTCATAAAGG + Intronic
955899375 3:63735704-63735726 GGACTCCCACACATTAATAATGG + Intergenic
957641272 3:82856427-82856449 GAAGACTCTCATATTGAGAAAGG - Intergenic
963926263 3:150954246-150954268 GGACTCTCTTACATTGCTAGTGG - Intronic
964897439 3:161614611-161614633 CTAGTCTCACACATTCATAAGGG - Intergenic
965030142 3:163355344-163355366 GGACTCTCACACAATAATAATGG - Intergenic
965522495 3:169681880-169681902 AGAGTCCCACACATTAATAATGG + Intergenic
967781098 3:193440461-193440483 GGAGTCACTCAGTTTGACAAGGG - Intronic
969454399 4:7292992-7293014 GGAGTCTGTGACATTGAAAATGG + Intronic
979352844 4:119665821-119665843 GAATTCTCATACATTGATAATGG + Intergenic
979964921 4:127066189-127066211 AGACTCCCACACATTGATAATGG - Intergenic
983906295 4:173185921-173185943 GGAATCTTTCAAATTGATTAAGG - Intronic
986478553 5:8160929-8160951 AGAGTCCCACACATTAATAATGG + Intergenic
988057277 5:26114402-26114424 GGACTCCCTCAACTTGATAAAGG + Intergenic
988731224 5:33975018-33975040 GGAGTCTCTCACTTTGTTTAAGG - Intronic
988892851 5:35637986-35638008 TGAGTTTCTCACTTTCATAAAGG - Intronic
990058843 5:51621267-51621289 TGAGTCACTCACATTGACAGTGG + Intergenic
991291962 5:65042006-65042028 GGTGTGTCTGACCTTGATAAAGG + Intergenic
992675201 5:79099503-79099525 AGACTCTCACACATTAATAATGG - Intronic
994962760 5:106626395-106626417 AGACTCTCACACATTAATAATGG - Intergenic
995315999 5:110775089-110775111 AGACTCTCACACATTAATAATGG + Intergenic
995855345 5:116585861-116585883 GGACTCTCTGACATTGAGACAGG - Intergenic
996921723 5:128775875-128775897 GAAGTCTAACACAATGATAATGG - Intronic
1006388142 6:33743508-33743530 GGAGTTTCTCACATGGCTGAGGG + Intronic
1006414510 6:33895494-33895516 GGAGTCTCTGACGTGGATCAGGG + Intergenic
1007129504 6:39456900-39456922 AGAGTCCCACACATTAATAATGG + Intronic
1008059034 6:46977424-46977446 AGAGGCTCTCACATTCAGAATGG - Intergenic
1008772355 6:54993828-54993850 GGATTCTTTCACATTGACACTGG - Intergenic
1014373380 6:120641108-120641130 GGACTCCCACACATTAATAATGG - Intergenic
1014956648 6:127626790-127626812 GCAGTGTCTCACCTTGATAAAGG - Intergenic
1015768388 6:136743562-136743584 GAAGTCTCATTCATTGATAATGG + Intronic
1016240074 6:141919243-141919265 AGACTCTCACACATTAATAATGG + Intergenic
1017334426 6:153238601-153238623 GGATTCTCCCACATTGCTAGTGG + Intergenic
1018220957 6:161579045-161579067 GGAGGCTCTCAGAGTGAAAAGGG + Intronic
1020953575 7:14710570-14710592 GAAGTTTCTCTCATTGATATTGG - Intronic
1021074394 7:16283822-16283844 GCAATCTCTAACATTTATAAAGG + Intronic
1021238504 7:18173063-18173085 GGACTCCCTCACAATAATAATGG - Intronic
1021933446 7:25605414-25605436 AGACTCCCACACATTGATAATGG + Intergenic
1023078432 7:36505593-36505615 GGACTTCCCCACATTGATAAAGG + Intergenic
1024895148 7:54251122-54251144 GGATTCTCAGACATTGCTAATGG - Intergenic
1027347853 7:77280157-77280179 GCAGTCTCTCGCTTTGATAAAGG + Intronic
1027768280 7:82374225-82374247 AGAGTCTCTGACATTTAAAAGGG + Intronic
1028633476 7:92961604-92961626 GTAGGCTTTCACATTGCTAAAGG + Intergenic
1029872260 7:103707204-103707226 GGAGGGTCTCACATTGATCTGGG - Intronic
1031441665 7:121802040-121802062 GGAGTCACACACATAAATAATGG - Intergenic
1033113419 7:138603846-138603868 GGAGTCTGTCACAAGGAGAAAGG - Intronic
1033268347 7:139907184-139907206 GGAGTTCCTCAACTTGATAAAGG - Intronic
1033985452 7:147220208-147220230 GGAAAATCTCATATTGATAAAGG - Intronic
1036024214 8:4885482-4885504 GGTGTTTCTCAACTTGATAAAGG - Intronic
1036577164 8:10038922-10038944 GGAGCTTCTAACATTAATAAAGG + Intergenic
1038389799 8:27185750-27185772 GCAGTCTCACACATTGCTGACGG - Intergenic
1040273413 8:45983639-45983661 AGACTCTCACACATTAATAATGG - Intergenic
1041747552 8:61224878-61224900 AGACTCTCTCACAATAATAATGG + Intronic
1045779196 8:105844268-105844290 AGACTCTCTCACAATAATAATGG - Intergenic
1046896314 8:119477481-119477503 GGACTCCCACACATTAATAATGG - Intergenic
1047917795 8:129601507-129601529 GCAGTTTCTCAACTTGATAAAGG - Intergenic
1048092180 8:131252851-131252873 GGACTCCCACACATTAATAATGG + Intergenic
1052671944 9:31569082-31569104 GAATTCTCTTACATTGCTAAAGG + Intergenic
1054339556 9:63845954-63845976 GGACTCCCACACATTAATAATGG + Intergenic
1058557454 9:106185234-106185256 AGACTCCCACACATTGATAATGG - Intergenic
1058579374 9:106438391-106438413 GGTAACTCTCACATTGTTAATGG + Intergenic
1203354168 Un_KI270442v1:115985-116007 AGACTCTCGCACATTAATAATGG + Intergenic
1203393436 Un_KI270508v1:199-221 AGACTCCCTCACATTAATAATGG - Intergenic
1188836847 X:34968125-34968147 GCAGTTTCTCAGTTTGATAATGG + Intergenic
1190058241 X:47194506-47194528 GGACTCTCTTACAGAGATAAAGG - Intronic
1191982873 X:66945185-66945207 GGACTCCCACACATTAATAATGG + Intergenic
1192041768 X:67630250-67630272 AGACTCTCACACATTAATAATGG - Intronic
1192294609 X:69834316-69834338 GGACTCCCACACATTAATAATGG - Intronic
1193069697 X:77294995-77295017 GGAGTCTTTCTCCTTGGTAAGGG - Intergenic
1193763533 X:85496171-85496193 GGATTCTCCCACAGTGATCATGG + Intergenic
1199092933 X:143712736-143712758 GGAGTGTCTCACTTTGACCAAGG - Intronic