ID: 1097495651

View in Genome Browser
Species Human (GRCh38)
Location 12:60328920-60328942
Sequence AATGGGTACCAGCAATTCAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097495647_1097495651 27 Left 1097495647 12:60328870-60328892 CCAGATGCAAAAGGAACTTGACA No data
Right 1097495651 12:60328920-60328942 AATGGGTACCAGCAATTCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097495651 Original CRISPR AATGGGTACCAGCAATTCAA CGG Intergenic
No off target data available for this crispr