ID: 1097507498

View in Genome Browser
Species Human (GRCh38)
Location 12:60494290-60494312
Sequence ATGGAGAAGCAGAGGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097507495_1097507498 -5 Left 1097507495 12:60494272-60494294 CCATAAAAGCAACAAAGGATGGA No data
Right 1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG No data
1097507492_1097507498 10 Left 1097507492 12:60494257-60494279 CCACTGGTAGTCATGCCATAAAA No data
Right 1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG No data
1097507490_1097507498 30 Left 1097507490 12:60494237-60494259 CCACTGGATGCTCACAGAAACCA No data
Right 1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097507498 Original CRISPR ATGGAGAAGCAGAGGAAGCA GGG Intergenic
No off target data available for this crispr