ID: 1097514117

View in Genome Browser
Species Human (GRCh38)
Location 12:60582159-60582181
Sequence TCTGCATAGAAGGAACTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097514110_1097514117 25 Left 1097514110 12:60582111-60582133 CCCCCAACATCTTACATACTTGT No data
Right 1097514117 12:60582159-60582181 TCTGCATAGAAGGAACTGTCTGG No data
1097514112_1097514117 23 Left 1097514112 12:60582113-60582135 CCCAACATCTTACATACTTGTAA No data
Right 1097514117 12:60582159-60582181 TCTGCATAGAAGGAACTGTCTGG No data
1097514111_1097514117 24 Left 1097514111 12:60582112-60582134 CCCCAACATCTTACATACTTGTA No data
Right 1097514117 12:60582159-60582181 TCTGCATAGAAGGAACTGTCTGG No data
1097514113_1097514117 22 Left 1097514113 12:60582114-60582136 CCAACATCTTACATACTTGTAAA No data
Right 1097514117 12:60582159-60582181 TCTGCATAGAAGGAACTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097514117 Original CRISPR TCTGCATAGAAGGAACTGTC TGG Intergenic
No off target data available for this crispr