ID: 1097522867

View in Genome Browser
Species Human (GRCh38)
Location 12:60690068-60690090
Sequence CAGGCACACATGAAGTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097522867_1097522871 22 Left 1097522867 12:60690068-60690090 CCTCAGGACTTCATGTGTGCCTG No data
Right 1097522871 12:60690113-60690135 ATATAGCTGTGCATGTGATATGG No data
1097522867_1097522872 27 Left 1097522867 12:60690068-60690090 CCTCAGGACTTCATGTGTGCCTG No data
Right 1097522872 12:60690118-60690140 GCTGTGCATGTGATATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097522867 Original CRISPR CAGGCACACATGAAGTCCTG AGG (reversed) Intergenic
No off target data available for this crispr