ID: 1097523277

View in Genome Browser
Species Human (GRCh38)
Location 12:60696407-60696429
Sequence CTACCTCAAAGCAAATCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097523275_1097523277 -8 Left 1097523275 12:60696392-60696414 CCACAGGCAGTTCCTCTACCTCA No data
Right 1097523277 12:60696407-60696429 CTACCTCAAAGCAAATCCGCTGG No data
1097523273_1097523277 -6 Left 1097523273 12:60696390-60696412 CCCCACAGGCAGTTCCTCTACCT No data
Right 1097523277 12:60696407-60696429 CTACCTCAAAGCAAATCCGCTGG No data
1097523274_1097523277 -7 Left 1097523274 12:60696391-60696413 CCCACAGGCAGTTCCTCTACCTC No data
Right 1097523277 12:60696407-60696429 CTACCTCAAAGCAAATCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097523277 Original CRISPR CTACCTCAAAGCAAATCCGC TGG Intergenic
No off target data available for this crispr