ID: 1097527303

View in Genome Browser
Species Human (GRCh38)
Location 12:60753277-60753299
Sequence CTGCATTTTGATCTGAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097527303_1097527307 23 Left 1097527303 12:60753277-60753299 CCAGTCTTCAGATCAAAATGCAG No data
Right 1097527307 12:60753323-60753345 TTTGTGAGCTCCTAAACACAGGG No data
1097527303_1097527306 22 Left 1097527303 12:60753277-60753299 CCAGTCTTCAGATCAAAATGCAG No data
Right 1097527306 12:60753322-60753344 CTTTGTGAGCTCCTAAACACAGG No data
1097527303_1097527308 24 Left 1097527303 12:60753277-60753299 CCAGTCTTCAGATCAAAATGCAG No data
Right 1097527308 12:60753324-60753346 TTGTGAGCTCCTAAACACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097527303 Original CRISPR CTGCATTTTGATCTGAAGAC TGG (reversed) Intergenic
No off target data available for this crispr