ID: 1097530710

View in Genome Browser
Species Human (GRCh38)
Location 12:60796346-60796368
Sequence TTTCTTGCAAAACTGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097530705_1097530710 21 Left 1097530705 12:60796302-60796324 CCTTTACTTGGCTTAGAAGTCAG No data
Right 1097530710 12:60796346-60796368 TTTCTTGCAAAACTGGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097530710 Original CRISPR TTTCTTGCAAAACTGGGCAA TGG Intergenic
No off target data available for this crispr