ID: 1097536376

View in Genome Browser
Species Human (GRCh38)
Location 12:60875576-60875598
Sequence CAAGTTCACTAGGTATCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097536372_1097536376 9 Left 1097536372 12:60875544-60875566 CCAATTCTTCACTTCTCAGACTG No data
Right 1097536376 12:60875576-60875598 CAAGTTCACTAGGTATCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097536376 Original CRISPR CAAGTTCACTAGGTATCTAC TGG Intergenic
No off target data available for this crispr