ID: 1097536843

View in Genome Browser
Species Human (GRCh38)
Location 12:60882889-60882911
Sequence CTGCTTTCTTTGGGCACAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097536838_1097536843 6 Left 1097536838 12:60882860-60882882 CCATAGGCATTCTGCTTTCTTTC No data
Right 1097536843 12:60882889-60882911 CTGCTTTCTTTGGGCACAATGGG No data
1097536837_1097536843 19 Left 1097536837 12:60882847-60882869 CCTTAGTCTATAGCCATAGGCAT No data
Right 1097536843 12:60882889-60882911 CTGCTTTCTTTGGGCACAATGGG No data
1097536835_1097536843 28 Left 1097536835 12:60882838-60882860 CCAGAAAATCCTTAGTCTATAGC No data
Right 1097536843 12:60882889-60882911 CTGCTTTCTTTGGGCACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097536843 Original CRISPR CTGCTTTCTTTGGGCACAAT GGG Intergenic
No off target data available for this crispr