ID: 1097548721

View in Genome Browser
Species Human (GRCh38)
Location 12:61039014-61039036
Sequence ATTTCAAGCTATAAATGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097548721_1097548723 -7 Left 1097548721 12:61039014-61039036 CCGCTGCATTTATAGCTTGAAAT No data
Right 1097548723 12:61039030-61039052 TTGAAATATTCCCACTGTGGTGG No data
1097548721_1097548724 -6 Left 1097548721 12:61039014-61039036 CCGCTGCATTTATAGCTTGAAAT No data
Right 1097548724 12:61039031-61039053 TGAAATATTCCCACTGTGGTGGG No data
1097548721_1097548722 -10 Left 1097548721 12:61039014-61039036 CCGCTGCATTTATAGCTTGAAAT No data
Right 1097548722 12:61039027-61039049 AGCTTGAAATATTCCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097548721 Original CRISPR ATTTCAAGCTATAAATGCAG CGG (reversed) Intergenic
No off target data available for this crispr