ID: 1097548722

View in Genome Browser
Species Human (GRCh38)
Location 12:61039027-61039049
Sequence AGCTTGAAATATTCCCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097548719_1097548722 27 Left 1097548719 12:61038977-61038999 CCTAATTGCTGGTTTTAAAATCT No data
Right 1097548722 12:61039027-61039049 AGCTTGAAATATTCCCACTGTGG No data
1097548721_1097548722 -10 Left 1097548721 12:61039014-61039036 CCGCTGCATTTATAGCTTGAAAT No data
Right 1097548722 12:61039027-61039049 AGCTTGAAATATTCCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097548722 Original CRISPR AGCTTGAAATATTCCCACTG TGG Intergenic
No off target data available for this crispr